ID: 925333287

View in Genome Browser
Species Human (GRCh38)
Location 2:3075148-3075170
Sequence TCCCTTCCGTATCACAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925333280_925333287 7 Left 925333280 2:3075118-3075140 CCTCGGTCTTCTACCCAGTGCCT No data
Right 925333287 2:3075148-3075170 TCCCTTCCGTATCACAGTGAGGG No data
925333278_925333287 21 Left 925333278 2:3075104-3075126 CCTTTGCCAGGGAACCTCGGTCT No data
Right 925333287 2:3075148-3075170 TCCCTTCCGTATCACAGTGAGGG No data
925333279_925333287 15 Left 925333279 2:3075110-3075132 CCAGGGAACCTCGGTCTTCTACC No data
Right 925333287 2:3075148-3075170 TCCCTTCCGTATCACAGTGAGGG No data
925333282_925333287 -7 Left 925333282 2:3075132-3075154 CCAGTGCCTCCCTGTTTCCCTTC No data
Right 925333287 2:3075148-3075170 TCCCTTCCGTATCACAGTGAGGG No data
925333281_925333287 -6 Left 925333281 2:3075131-3075153 CCCAGTGCCTCCCTGTTTCCCTT No data
Right 925333287 2:3075148-3075170 TCCCTTCCGTATCACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925333287 Original CRISPR TCCCTTCCGTATCACAGTGA GGG Intergenic
No off target data available for this crispr