ID: 925336485

View in Genome Browser
Species Human (GRCh38)
Location 2:3102492-3102514
Sequence GGCCTTCTGGGTCACAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925336481_925336485 -9 Left 925336481 2:3102478-3102500 CCAACGCTGGGGCCGGCCTTCTG No data
Right 925336485 2:3102492-3102514 GGCCTTCTGGGTCACAGTGCTGG No data
925336478_925336485 1 Left 925336478 2:3102468-3102490 CCCGCGAGGACCAACGCTGGGGC No data
Right 925336485 2:3102492-3102514 GGCCTTCTGGGTCACAGTGCTGG No data
925336479_925336485 0 Left 925336479 2:3102469-3102491 CCGCGAGGACCAACGCTGGGGCC No data
Right 925336485 2:3102492-3102514 GGCCTTCTGGGTCACAGTGCTGG No data
925336471_925336485 25 Left 925336471 2:3102444-3102466 CCTCACCGGGGTCCACACAAGCG No data
Right 925336485 2:3102492-3102514 GGCCTTCTGGGTCACAGTGCTGG No data
925336472_925336485 20 Left 925336472 2:3102449-3102471 CCGGGGTCCACACAAGCGTCCCG No data
Right 925336485 2:3102492-3102514 GGCCTTCTGGGTCACAGTGCTGG No data
925336474_925336485 13 Left 925336474 2:3102456-3102478 CCACACAAGCGTCCCGCGAGGAC No data
Right 925336485 2:3102492-3102514 GGCCTTCTGGGTCACAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925336485 Original CRISPR GGCCTTCTGGGTCACAGTGC TGG Intergenic
No off target data available for this crispr