ID: 925338076

View in Genome Browser
Species Human (GRCh38)
Location 2:3113289-3113311
Sequence CCTTCACACGATGGGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925338076_925338081 -6 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338081 2:3113306-3113328 TGAAGGTTCAGAGCTTCAGCTGG No data
925338076_925338086 6 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338086 2:3113318-3113340 GCTTCAGCTGGGAAGGGGCCAGG No data
925338076_925338090 18 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338090 2:3113330-3113352 AAGGGGCCAGGATGGGGTGATGG No data
925338076_925338088 11 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338088 2:3113323-3113345 AGCTGGGAAGGGGCCAGGATGGG No data
925338076_925338082 -5 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338082 2:3113307-3113329 GAAGGTTCAGAGCTTCAGCTGGG No data
925338076_925338083 -1 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338083 2:3113311-3113333 GTTCAGAGCTTCAGCTGGGAAGG No data
925338076_925338084 0 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338084 2:3113312-3113334 TTCAGAGCTTCAGCTGGGAAGGG No data
925338076_925338091 19 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338091 2:3113331-3113353 AGGGGCCAGGATGGGGTGATGGG No data
925338076_925338085 1 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338085 2:3113313-3113335 TCAGAGCTTCAGCTGGGAAGGGG No data
925338076_925338089 12 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338089 2:3113324-3113346 GCTGGGAAGGGGCCAGGATGGGG No data
925338076_925338087 10 Left 925338076 2:3113289-3113311 CCTCCAAACCCATCGTGTGAAGG No data
Right 925338087 2:3113322-3113344 CAGCTGGGAAGGGGCCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925338076 Original CRISPR CCTTCACACGATGGGTTTGG AGG (reversed) Intergenic
No off target data available for this crispr