ID: 925339523

View in Genome Browser
Species Human (GRCh38)
Location 2:3126515-3126537
Sequence CTCAACCAGCAGCAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925339517_925339523 17 Left 925339517 2:3126475-3126497 CCCAAATGACAAAGATCTCTGAG No data
Right 925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG No data
925339518_925339523 16 Left 925339518 2:3126476-3126498 CCAAATGACAAAGATCTCTGAGT No data
Right 925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925339523 Original CRISPR CTCAACCAGCAGCAGCAGAG GGG Intergenic
No off target data available for this crispr