ID: 925340542

View in Genome Browser
Species Human (GRCh38)
Location 2:3132568-3132590
Sequence GTGGAATCCAGGATCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925340542_925340551 20 Left 925340542 2:3132568-3132590 CCCAGGCAGATCCTGGATTCCAC No data
Right 925340551 2:3132611-3132633 CCCCACCCTCACACTTCCCATGG No data
925340542_925340556 28 Left 925340542 2:3132568-3132590 CCCAGGCAGATCCTGGATTCCAC No data
Right 925340556 2:3132619-3132641 TCACACTTCCCATGGCCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925340542 Original CRISPR GTGGAATCCAGGATCTGCCT GGG (reversed) Intergenic
No off target data available for this crispr