ID: 925340543

View in Genome Browser
Species Human (GRCh38)
Location 2:3132569-3132591
Sequence AGTGGAATCCAGGATCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925340543_925340551 19 Left 925340543 2:3132569-3132591 CCAGGCAGATCCTGGATTCCACT No data
Right 925340551 2:3132611-3132633 CCCCACCCTCACACTTCCCATGG No data
925340543_925340556 27 Left 925340543 2:3132569-3132591 CCAGGCAGATCCTGGATTCCACT No data
Right 925340556 2:3132619-3132641 TCACACTTCCCATGGCCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925340543 Original CRISPR AGTGGAATCCAGGATCTGCC TGG (reversed) Intergenic
No off target data available for this crispr