ID: 925342700

View in Genome Browser
Species Human (GRCh38)
Location 2:3148119-3148141
Sequence GCAGCGGGGGAGCTGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925342700_925342719 28 Left 925342700 2:3148119-3148141 CCACCCAGCAGCTCCCCCGCTGC No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342700_925342710 -2 Left 925342700 2:3148119-3148141 CCACCCAGCAGCTCCCCCGCTGC No data
Right 925342710 2:3148140-3148162 GCCCCACCTCGGGCAGGCAACGG No data
925342700_925342708 -8 Left 925342700 2:3148119-3148141 CCACCCAGCAGCTCCCCCGCTGC No data
Right 925342708 2:3148134-3148156 CCCGCTGCCCCACCTCGGGCAGG No data
925342700_925342718 27 Left 925342700 2:3148119-3148141 CCACCCAGCAGCTCCCCCGCTGC No data
Right 925342718 2:3148169-3148191 CAATCCCTGCAGATAGAGACAGG No data
925342700_925342720 29 Left 925342700 2:3148119-3148141 CCACCCAGCAGCTCCCCCGCTGC No data
Right 925342720 2:3148171-3148193 ATCCCTGCAGATAGAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925342700 Original CRISPR GCAGCGGGGGAGCTGCTGGG TGG (reversed) Intergenic