ID: 925342701

View in Genome Browser
Species Human (GRCh38)
Location 2:3148122-3148144
Sequence GGGGCAGCGGGGGAGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925342701_925342718 24 Left 925342701 2:3148122-3148144 CCCAGCAGCTCCCCCGCTGCCCC No data
Right 925342718 2:3148169-3148191 CAATCCCTGCAGATAGAGACAGG No data
925342701_925342710 -5 Left 925342701 2:3148122-3148144 CCCAGCAGCTCCCCCGCTGCCCC No data
Right 925342710 2:3148140-3148162 GCCCCACCTCGGGCAGGCAACGG No data
925342701_925342719 25 Left 925342701 2:3148122-3148144 CCCAGCAGCTCCCCCGCTGCCCC No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342701_925342720 26 Left 925342701 2:3148122-3148144 CCCAGCAGCTCCCCCGCTGCCCC No data
Right 925342720 2:3148171-3148193 ATCCCTGCAGATAGAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925342701 Original CRISPR GGGGCAGCGGGGGAGCTGCT GGG (reversed) Intergenic