ID: 925342702

View in Genome Browser
Species Human (GRCh38)
Location 2:3148123-3148145
Sequence TGGGGCAGCGGGGGAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925342702_925342710 -6 Left 925342702 2:3148123-3148145 CCAGCAGCTCCCCCGCTGCCCCA No data
Right 925342710 2:3148140-3148162 GCCCCACCTCGGGCAGGCAACGG No data
925342702_925342720 25 Left 925342702 2:3148123-3148145 CCAGCAGCTCCCCCGCTGCCCCA No data
Right 925342720 2:3148171-3148193 ATCCCTGCAGATAGAGACAGGGG No data
925342702_925342719 24 Left 925342702 2:3148123-3148145 CCAGCAGCTCCCCCGCTGCCCCA No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342702_925342718 23 Left 925342702 2:3148123-3148145 CCAGCAGCTCCCCCGCTGCCCCA No data
Right 925342718 2:3148169-3148191 CAATCCCTGCAGATAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925342702 Original CRISPR TGGGGCAGCGGGGGAGCTGC TGG (reversed) Intergenic