ID: 925342705 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:3148132-3148154 |
Sequence | TGCCCGAGGTGGGGCAGCGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
925342705_925342718 | 14 | Left | 925342705 | 2:3148132-3148154 | CCCCCGCTGCCCCACCTCGGGCA | No data | ||
Right | 925342718 | 2:3148169-3148191 | CAATCCCTGCAGATAGAGACAGG | No data | ||||
925342705_925342719 | 15 | Left | 925342705 | 2:3148132-3148154 | CCCCCGCTGCCCCACCTCGGGCA | No data | ||
Right | 925342719 | 2:3148170-3148192 | AATCCCTGCAGATAGAGACAGGG | No data | ||||
925342705_925342720 | 16 | Left | 925342705 | 2:3148132-3148154 | CCCCCGCTGCCCCACCTCGGGCA | No data | ||
Right | 925342720 | 2:3148171-3148193 | ATCCCTGCAGATAGAGACAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
925342705 | Original CRISPR | TGCCCGAGGTGGGGCAGCGG GGG (reversed) | Intergenic | ||