ID: 925342707

View in Genome Browser
Species Human (GRCh38)
Location 2:3148134-3148156
Sequence CCTGCCCGAGGTGGGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925342707_925342719 13 Left 925342707 2:3148134-3148156 CCCGCTGCCCCACCTCGGGCAGG No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342707_925342720 14 Left 925342707 2:3148134-3148156 CCCGCTGCCCCACCTCGGGCAGG No data
Right 925342720 2:3148171-3148193 ATCCCTGCAGATAGAGACAGGGG No data
925342707_925342718 12 Left 925342707 2:3148134-3148156 CCCGCTGCCCCACCTCGGGCAGG No data
Right 925342718 2:3148169-3148191 CAATCCCTGCAGATAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925342707 Original CRISPR CCTGCCCGAGGTGGGGCAGC GGG (reversed) Intergenic