ID: 925342709

View in Genome Browser
Species Human (GRCh38)
Location 2:3148135-3148157
Sequence GCCTGCCCGAGGTGGGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925342709_925342718 11 Left 925342709 2:3148135-3148157 CCGCTGCCCCACCTCGGGCAGGC No data
Right 925342718 2:3148169-3148191 CAATCCCTGCAGATAGAGACAGG No data
925342709_925342719 12 Left 925342709 2:3148135-3148157 CCGCTGCCCCACCTCGGGCAGGC No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342709_925342720 13 Left 925342709 2:3148135-3148157 CCGCTGCCCCACCTCGGGCAGGC No data
Right 925342720 2:3148171-3148193 ATCCCTGCAGATAGAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925342709 Original CRISPR GCCTGCCCGAGGTGGGGCAG CGG (reversed) Intergenic