ID: 925342711

View in Genome Browser
Species Human (GRCh38)
Location 2:3148141-3148163
Sequence TCCGTTGCCTGCCCGAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925342711_925342718 5 Left 925342711 2:3148141-3148163 CCCCACCTCGGGCAGGCAACGGA No data
Right 925342718 2:3148169-3148191 CAATCCCTGCAGATAGAGACAGG No data
925342711_925342723 27 Left 925342711 2:3148141-3148163 CCCCACCTCGGGCAGGCAACGGA No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342711_925342720 7 Left 925342711 2:3148141-3148163 CCCCACCTCGGGCAGGCAACGGA No data
Right 925342720 2:3148171-3148193 ATCCCTGCAGATAGAGACAGGGG No data
925342711_925342719 6 Left 925342711 2:3148141-3148163 CCCCACCTCGGGCAGGCAACGGA No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925342711 Original CRISPR TCCGTTGCCTGCCCGAGGTG GGG (reversed) Intergenic
No off target data available for this crispr