ID: 925342713

View in Genome Browser
Species Human (GRCh38)
Location 2:3148143-3148165
Sequence AATCCGTTGCCTGCCCGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925342713_925342720 5 Left 925342713 2:3148143-3148165 CCACCTCGGGCAGGCAACGGATT No data
Right 925342720 2:3148171-3148193 ATCCCTGCAGATAGAGACAGGGG No data
925342713_925342723 25 Left 925342713 2:3148143-3148165 CCACCTCGGGCAGGCAACGGATT No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342713_925342719 4 Left 925342713 2:3148143-3148165 CCACCTCGGGCAGGCAACGGATT No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342713_925342718 3 Left 925342713 2:3148143-3148165 CCACCTCGGGCAGGCAACGGATT No data
Right 925342718 2:3148169-3148191 CAATCCCTGCAGATAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925342713 Original CRISPR AATCCGTTGCCTGCCCGAGG TGG (reversed) Intergenic