ID: 925342714

View in Genome Browser
Species Human (GRCh38)
Location 2:3148146-3148168
Sequence GGGAATCCGTTGCCTGCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925342714_925342723 22 Left 925342714 2:3148146-3148168 CCTCGGGCAGGCAACGGATTCCC No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342714_925342720 2 Left 925342714 2:3148146-3148168 CCTCGGGCAGGCAACGGATTCCC No data
Right 925342720 2:3148171-3148193 ATCCCTGCAGATAGAGACAGGGG No data
925342714_925342718 0 Left 925342714 2:3148146-3148168 CCTCGGGCAGGCAACGGATTCCC No data
Right 925342718 2:3148169-3148191 CAATCCCTGCAGATAGAGACAGG No data
925342714_925342719 1 Left 925342714 2:3148146-3148168 CCTCGGGCAGGCAACGGATTCCC No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342714_925342726 30 Left 925342714 2:3148146-3148168 CCTCGGGCAGGCAACGGATTCCC No data
Right 925342726 2:3148199-3148221 CTGATCTCACGCAGGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925342714 Original CRISPR GGGAATCCGTTGCCTGCCCG AGG (reversed) Intergenic