ID: 925342719

View in Genome Browser
Species Human (GRCh38)
Location 2:3148170-3148192
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925342709_925342719 12 Left 925342709 2:3148135-3148157 CCGCTGCCCCACCTCGGGCAGGC No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342712_925342719 5 Left 925342712 2:3148142-3148164 CCCACCTCGGGCAGGCAACGGAT No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342702_925342719 24 Left 925342702 2:3148123-3148145 CCAGCAGCTCCCCCGCTGCCCCA No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342705_925342719 15 Left 925342705 2:3148132-3148154 CCCCCGCTGCCCCACCTCGGGCA No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342700_925342719 28 Left 925342700 2:3148119-3148141 CCACCCAGCAGCTCCCCCGCTGC No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342713_925342719 4 Left 925342713 2:3148143-3148165 CCACCTCGGGCAGGCAACGGATT No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342714_925342719 1 Left 925342714 2:3148146-3148168 CCTCGGGCAGGCAACGGATTCCC No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342711_925342719 6 Left 925342711 2:3148141-3148163 CCCCACCTCGGGCAGGCAACGGA No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342707_925342719 13 Left 925342707 2:3148134-3148156 CCCGCTGCCCCACCTCGGGCAGG No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342706_925342719 14 Left 925342706 2:3148133-3148155 CCCCGCTGCCCCACCTCGGGCAG No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data
925342701_925342719 25 Left 925342701 2:3148122-3148144 CCCAGCAGCTCCCCCGCTGCCCC No data
Right 925342719 2:3148170-3148192 AATCCCTGCAGATAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr