ID: 925342723

View in Genome Browser
Species Human (GRCh38)
Location 2:3148191-3148213
Sequence GGGCATCCCTGATCTCACGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925342714_925342723 22 Left 925342714 2:3148146-3148168 CCTCGGGCAGGCAACGGATTCCC No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342713_925342723 25 Left 925342713 2:3148143-3148165 CCACCTCGGGCAGGCAACGGATT No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342712_925342723 26 Left 925342712 2:3148142-3148164 CCCACCTCGGGCAGGCAACGGAT No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342717_925342723 0 Left 925342717 2:3148168-3148190 CCAATCCCTGCAGATAGAGACAG No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342716_925342723 1 Left 925342716 2:3148167-3148189 CCCAATCCCTGCAGATAGAGACA No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342722_925342723 -6 Left 925342722 2:3148174-3148196 CCTGCAGATAGAGACAGGGGCAT No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342715_925342723 2 Left 925342715 2:3148166-3148188 CCCCAATCCCTGCAGATAGAGAC No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342711_925342723 27 Left 925342711 2:3148141-3148163 CCCCACCTCGGGCAGGCAACGGA No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data
925342721_925342723 -5 Left 925342721 2:3148173-3148195 CCCTGCAGATAGAGACAGGGGCA No data
Right 925342723 2:3148191-3148213 GGGCATCCCTGATCTCACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925342723 Original CRISPR GGGCATCCCTGATCTCACGC AGG Intergenic
No off target data available for this crispr