ID: 925343029

View in Genome Browser
Species Human (GRCh38)
Location 2:3149759-3149781
Sequence CTCCTGGACGTTCCTGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925343023_925343029 24 Left 925343023 2:3149712-3149734 CCTTTTCTGCAACAGAACTTGGG No data
Right 925343029 2:3149759-3149781 CTCCTGGACGTTCCTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925343029 Original CRISPR CTCCTGGACGTTCCTGCCAA GGG Intergenic
No off target data available for this crispr