ID: 925346264

View in Genome Browser
Species Human (GRCh38)
Location 2:3174104-3174126
Sequence CTACTTTACCACGACCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925346261_925346264 12 Left 925346261 2:3174069-3174091 CCAGTACATGTTTGCTGAATGAA No data
Right 925346264 2:3174104-3174126 CTACTTTACCACGACCCCATTGG No data
925346260_925346264 13 Left 925346260 2:3174068-3174090 CCCAGTACATGTTTGCTGAATGA No data
Right 925346264 2:3174104-3174126 CTACTTTACCACGACCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925346264 Original CRISPR CTACTTTACCACGACCCCAT TGG Intergenic
No off target data available for this crispr