ID: 925346787

View in Genome Browser
Species Human (GRCh38)
Location 2:3177252-3177274
Sequence AGCCAGAGTGGGATCAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925346787_925346793 14 Left 925346787 2:3177252-3177274 CCTGCTTTGATCCCACTCTGGCT No data
Right 925346793 2:3177289-3177311 CAACCACAGGCCTTTGCTGGTGG No data
925346787_925346791 1 Left 925346787 2:3177252-3177274 CCTGCTTTGATCCCACTCTGGCT No data
Right 925346791 2:3177276-3177298 ACAGTGACTGGCTCAACCACAGG No data
925346787_925346792 11 Left 925346787 2:3177252-3177274 CCTGCTTTGATCCCACTCTGGCT No data
Right 925346792 2:3177286-3177308 GCTCAACCACAGGCCTTTGCTGG No data
925346787_925346796 23 Left 925346787 2:3177252-3177274 CCTGCTTTGATCCCACTCTGGCT No data
Right 925346796 2:3177298-3177320 GCCTTTGCTGGTGGGTTCTGAGG No data
925346787_925346794 15 Left 925346787 2:3177252-3177274 CCTGCTTTGATCCCACTCTGGCT No data
Right 925346794 2:3177290-3177312 AACCACAGGCCTTTGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925346787 Original CRISPR AGCCAGAGTGGGATCAAAGC AGG (reversed) Intergenic
No off target data available for this crispr