ID: 925346788

View in Genome Browser
Species Human (GRCh38)
Location 2:3177263-3177285
Sequence CAGTCACTGTGAGCCAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925346788_925346793 3 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346793 2:3177289-3177311 CAACCACAGGCCTTTGCTGGTGG No data
925346788_925346794 4 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346794 2:3177290-3177312 AACCACAGGCCTTTGCTGGTGGG No data
925346788_925346796 12 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346796 2:3177298-3177320 GCCTTTGCTGGTGGGTTCTGAGG No data
925346788_925346798 25 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346798 2:3177311-3177333 GGTTCTGAGGTGAGAGCATTTGG No data
925346788_925346800 27 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346800 2:3177313-3177335 TTCTGAGGTGAGAGCATTTGGGG No data
925346788_925346792 0 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346792 2:3177286-3177308 GCTCAACCACAGGCCTTTGCTGG No data
925346788_925346791 -10 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346791 2:3177276-3177298 ACAGTGACTGGCTCAACCACAGG No data
925346788_925346799 26 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346799 2:3177312-3177334 GTTCTGAGGTGAGAGCATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925346788 Original CRISPR CAGTCACTGTGAGCCAGAGT GGG (reversed) Intergenic
No off target data available for this crispr