ID: 925346789

View in Genome Browser
Species Human (GRCh38)
Location 2:3177264-3177286
Sequence CCAGTCACTGTGAGCCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925346789_925346800 26 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346800 2:3177313-3177335 TTCTGAGGTGAGAGCATTTGGGG No data
925346789_925346792 -1 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346792 2:3177286-3177308 GCTCAACCACAGGCCTTTGCTGG No data
925346789_925346794 3 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346794 2:3177290-3177312 AACCACAGGCCTTTGCTGGTGGG No data
925346789_925346799 25 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346799 2:3177312-3177334 GTTCTGAGGTGAGAGCATTTGGG No data
925346789_925346793 2 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346793 2:3177289-3177311 CAACCACAGGCCTTTGCTGGTGG No data
925346789_925346796 11 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346796 2:3177298-3177320 GCCTTTGCTGGTGGGTTCTGAGG No data
925346789_925346798 24 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346798 2:3177311-3177333 GGTTCTGAGGTGAGAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925346789 Original CRISPR CCAGTCACTGTGAGCCAGAG TGG (reversed) Intergenic
No off target data available for this crispr