ID: 925346792

View in Genome Browser
Species Human (GRCh38)
Location 2:3177286-3177308
Sequence GCTCAACCACAGGCCTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925346785_925346792 20 Left 925346785 2:3177243-3177265 CCTTGCACACCTGCTTTGATCCC No data
Right 925346792 2:3177286-3177308 GCTCAACCACAGGCCTTTGCTGG No data
925346788_925346792 0 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346792 2:3177286-3177308 GCTCAACCACAGGCCTTTGCTGG No data
925346787_925346792 11 Left 925346787 2:3177252-3177274 CCTGCTTTGATCCCACTCTGGCT No data
Right 925346792 2:3177286-3177308 GCTCAACCACAGGCCTTTGCTGG No data
925346789_925346792 -1 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346792 2:3177286-3177308 GCTCAACCACAGGCCTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925346792 Original CRISPR GCTCAACCACAGGCCTTTGC TGG Intergenic
No off target data available for this crispr