ID: 925346794

View in Genome Browser
Species Human (GRCh38)
Location 2:3177290-3177312
Sequence AACCACAGGCCTTTGCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925346788_925346794 4 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346794 2:3177290-3177312 AACCACAGGCCTTTGCTGGTGGG No data
925346789_925346794 3 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346794 2:3177290-3177312 AACCACAGGCCTTTGCTGGTGGG No data
925346787_925346794 15 Left 925346787 2:3177252-3177274 CCTGCTTTGATCCCACTCTGGCT No data
Right 925346794 2:3177290-3177312 AACCACAGGCCTTTGCTGGTGGG No data
925346785_925346794 24 Left 925346785 2:3177243-3177265 CCTTGCACACCTGCTTTGATCCC No data
Right 925346794 2:3177290-3177312 AACCACAGGCCTTTGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925346794 Original CRISPR AACCACAGGCCTTTGCTGGT GGG Intergenic
No off target data available for this crispr