ID: 925346798

View in Genome Browser
Species Human (GRCh38)
Location 2:3177311-3177333
Sequence GGTTCTGAGGTGAGAGCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925346795_925346798 -4 Left 925346795 2:3177292-3177314 CCACAGGCCTTTGCTGGTGGGTT No data
Right 925346798 2:3177311-3177333 GGTTCTGAGGTGAGAGCATTTGG No data
925346789_925346798 24 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346798 2:3177311-3177333 GGTTCTGAGGTGAGAGCATTTGG No data
925346788_925346798 25 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346798 2:3177311-3177333 GGTTCTGAGGTGAGAGCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925346798 Original CRISPR GGTTCTGAGGTGAGAGCATT TGG Intergenic
No off target data available for this crispr