ID: 925346800

View in Genome Browser
Species Human (GRCh38)
Location 2:3177313-3177335
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925346788_925346800 27 Left 925346788 2:3177263-3177285 CCCACTCTGGCTCACAGTGACTG No data
Right 925346800 2:3177313-3177335 TTCTGAGGTGAGAGCATTTGGGG No data
925346789_925346800 26 Left 925346789 2:3177264-3177286 CCACTCTGGCTCACAGTGACTGG No data
Right 925346800 2:3177313-3177335 TTCTGAGGTGAGAGCATTTGGGG No data
925346795_925346800 -2 Left 925346795 2:3177292-3177314 CCACAGGCCTTTGCTGGTGGGTT No data
Right 925346800 2:3177313-3177335 TTCTGAGGTGAGAGCATTTGGGG No data
925346797_925346800 -9 Left 925346797 2:3177299-3177321 CCTTTGCTGGTGGGTTCTGAGGT No data
Right 925346800 2:3177313-3177335 TTCTGAGGTGAGAGCATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr