ID: 925358103

View in Genome Browser
Species Human (GRCh38)
Location 2:3256843-3256865
Sequence TGCCCAAGCCCGCCCGTGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925358103_925358110 21 Left 925358103 2:3256843-3256865 CCGGACACGGGCGGGCTTGGGCA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 925358110 2:3256887-3256909 CGCATTCATGCTTTGTCCACGGG 0: 1
1: 0
2: 0
3: 8
4: 63
925358103_925358104 -9 Left 925358103 2:3256843-3256865 CCGGACACGGGCGGGCTTGGGCA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 925358104 2:3256857-3256879 GCTTGGGCACGCAGCCCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 99
925358103_925358109 20 Left 925358103 2:3256843-3256865 CCGGACACGGGCGGGCTTGGGCA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 925358109 2:3256886-3256908 ACGCATTCATGCTTTGTCCACGG 0: 1
1: 0
2: 1
3: 4
4: 93
925358103_925358113 29 Left 925358103 2:3256843-3256865 CCGGACACGGGCGGGCTTGGGCA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 925358113 2:3256895-3256917 TGCTTTGTCCACGGGAGGAAGGG 0: 1
1: 0
2: 0
3: 16
4: 131
925358103_925358112 28 Left 925358103 2:3256843-3256865 CCGGACACGGGCGGGCTTGGGCA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 925358112 2:3256894-3256916 ATGCTTTGTCCACGGGAGGAAGG 0: 1
1: 0
2: 0
3: 7
4: 92
925358103_925358111 24 Left 925358103 2:3256843-3256865 CCGGACACGGGCGGGCTTGGGCA 0: 1
1: 0
2: 0
3: 3
4: 72
Right 925358111 2:3256890-3256912 ATTCATGCTTTGTCCACGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925358103 Original CRISPR TGCCCAAGCCCGCCCGTGTC CGG (reversed) Intronic
900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG + Intronic
901454553 1:9355599-9355621 GGCTCCAGCCTGCCCGTGTCAGG + Intronic
905466243 1:38155844-38155866 CCCCCAACCCCGCCCGAGTCTGG - Intergenic
905474618 1:38217469-38217491 TGCCCAAGCAAGCCTGTGGCTGG - Intergenic
1063410431 10:5832958-5832980 TGCCCCATCCCACCAGTGTCAGG + Intronic
1077410869 11:2403345-2403367 TTCCCAAGGCCGCCCCTGCCTGG - Exonic
1081761050 11:45576639-45576661 TGCCCATGGCCGCCCCGGTCAGG - Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1082794481 11:57369571-57369593 TGGCCAAGCCTTCCCTTGTCTGG - Intronic
1084408199 11:68991168-68991190 TGCCCAAGCCCGCCTGGGAAGGG - Intergenic
1087977230 11:104565040-104565062 TGCCCAAGCCCCCCTGTGGTAGG - Intergenic
1089292327 11:117444851-117444873 AGCCCCATCCCGCCCGTGCCAGG - Intronic
1092860792 12:12717544-12717566 TGGCAAAGCCCGTCCGAGTCTGG - Exonic
1103608445 12:122106025-122106047 TGCCCAGGCCAGCCCCTGGCTGG + Intronic
1113848491 13:113405147-113405169 TCCCCAGGTCCGCCTGTGTCAGG + Intergenic
1113873921 13:113583042-113583064 TGGCCTAGCCCGCCCTTGGCTGG + Intergenic
1114131795 14:19800717-19800739 GGCCCAAGCCGGGCCATGTCTGG - Intronic
1121272129 14:92644800-92644822 GGCCCAAGCCTGCCCATGCCAGG - Intronic
1122425033 14:101600968-101600990 AGCCCAAGCCCTCCCGTCTCGGG + Intergenic
1122836088 14:104431792-104431814 TGCCCAAGCCCTCCTGCTTCTGG - Intergenic
1123574865 15:21656421-21656443 GGCCAAAGCCGGGCCGTGTCTGG - Intergenic
1123611480 15:22098910-22098932 GGCCAAAGCCGGGCCGTGTCTGG - Intergenic
1129756243 15:78101003-78101025 TGCCCAAGCCTAGCCGTGCCTGG - Exonic
1130406360 15:83605759-83605781 TGTCCAAGCCCGCGAGTGTGGGG + Intronic
1132698584 16:1212671-1212693 TGCGCTCGCCCGCCAGTGTCCGG + Intronic
1134816213 16:17207878-17207900 TGGCCAAGCCAGCACCTGTCAGG + Intronic
1137589637 16:49685731-49685753 TGCCCACGCCCGTCCTTGACAGG + Intronic
1142622204 17:1172250-1172272 TGCCCAATCCCACCCCTGCCTGG - Intronic
1146497558 17:33336658-33336680 TGCTCAAGGCTGCCTGTGTCTGG + Intronic
1153687804 18:7564639-7564661 TGCCCAAGCCTACCAATGTCAGG + Intergenic
1160027231 18:75228528-75228550 AGCCCAGGCTCTCCCGTGTCAGG + Intronic
1160833995 19:1116203-1116225 TGCCCAGGCCCGGTCCTGTCCGG - Intronic
1162808243 19:13150078-13150100 TACCCAAGCCAGCCAGTGCCCGG - Intronic
1166376153 19:42328283-42328305 TGCCCAGGACCTCCCCTGTCTGG - Intronic
924985210 2:264284-264306 GGCCCAAGGCCGCCCTGGTCCGG + Intronic
925358103 2:3256843-3256865 TGCCCAAGCCCGCCCGTGTCCGG - Intronic
925563961 2:5229492-5229514 TGTGGAAGCCTGCCCGTGTCAGG + Intergenic
928130909 2:28649414-28649436 CCCCCAAGCCAGCCCCTGTCAGG + Intergenic
929579216 2:43071135-43071157 TGCCCACGCCTGCCCCTCTCAGG - Intergenic
1171451687 20:25240155-25240177 TGCCCCAGCCCTCCCCTGACAGG - Intergenic
1171982527 20:31637989-31638011 CACCCAAGCCCGCGCGGGTCAGG + Intronic
1173162188 20:40661272-40661294 GTCCCCAGCCCGCCCATGTCTGG - Intergenic
1174979551 20:55378123-55378145 TGCCAAAGCCTGCGGGTGTCAGG - Intergenic
1175924370 20:62464812-62464834 TCCCCAGGCCAGCCCATGTCAGG - Exonic
1175956484 20:62612314-62612336 TGCCCAAGGCCCCCTGTGCCTGG - Intergenic
1181035428 22:20167757-20167779 TGCCCGGGCCCGCACCTGTCTGG - Intergenic
1181103528 22:20557725-20557747 TGCCCACGCCCTCCCCAGTCTGG + Intronic
1182517459 22:30867162-30867184 TGCCCAAGCCCACCCCTTCCTGG + Intronic
1183261336 22:36797795-36797817 TGCCCAATCCCACCCGTGATGGG + Intergenic
1185053975 22:48568471-48568493 TGTCCCAGCCAGCCCTTGTCTGG - Intronic
960691009 3:120346935-120346957 TGGGCAAGTCAGCCCGTGTCAGG - Intronic
963904706 3:150763529-150763551 CGCCCCTGCCCGCCCGCGTCCGG - Intergenic
965652398 3:170947496-170947518 TGCCCAAGCCCACCTGTGGTGGG + Intergenic
969637594 4:8378282-8378304 TCCCCCAGCTCGCCCGTGCCGGG - Intronic
972675618 4:41257234-41257256 CGCCCCAGCCCGGCCGTCTCCGG - Intronic
980088668 4:128418287-128418309 TTCCCAAGCCTGCCTGTTTCAGG - Intergenic
981103948 4:140859229-140859251 TGGCCTAGCCCCCCCGTGCCTGG - Intergenic
985517488 5:354406-354428 TGCCCACGCCAGGCCGTGCCCGG + Intronic
992249960 5:74866530-74866552 TGGCCAAGCCCGCACCTGCCGGG - Intronic
997110318 5:131067169-131067191 TTTCCAAGCCAGCCTGTGTCTGG - Intergenic
998017589 5:138744949-138744971 TCACCAAGCCCTCCCGAGTCTGG + Intronic
1012997038 6:105984487-105984509 TGCCCATGCCCACTCCTGTCTGG - Intergenic
1014088345 6:117373377-117373399 TGCCCAAGTCCCCCCGTGGTGGG - Intronic
1017751075 6:157491045-157491067 TGCCCATGCCAGCCAGTGACAGG - Intronic
1017935184 6:158999407-158999429 TGACCAAGCCAGCCCCTGTGTGG - Intronic
1019292479 7:257469-257491 CGCCCAAGACCCCCCGTGGCAGG - Intronic
1019529365 7:1495861-1495883 TCCCCACTCCCGCCCGTGGCTGG + Intronic
1022941864 7:35249402-35249424 GGCCAAAGCCCGCCCGGCTCTGG + Intronic
1028493191 7:91436832-91436854 TGCCCGAGCCCACCAGGGTCGGG + Intergenic
1035526610 8:317837-317859 TGCCGACGGCCGCCCGGGTCTGG + Intergenic
1040965538 8:53077719-53077741 TGCCCAAGCCCCCCCGGGGTGGG - Intergenic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1047220167 8:122912316-122912338 TGCCCAGGCCAGCCTGTGGCTGG - Intronic
1057570244 9:96198779-96198801 TGCCCCAGCCGGCTCCTGTCTGG - Intergenic
1060869708 9:127029789-127029811 GGCCCAACCCTGACCGTGTCTGG - Intronic
1187190267 X:17027969-17027991 TGGCCAAGCCTGCCTGTGACTGG - Intronic