ID: 925360084

View in Genome Browser
Species Human (GRCh38)
Location 2:3272603-3272625
Sequence TCTTACATGGGCATGGTTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 2, 1: 11, 2: 79, 3: 195, 4: 481}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925360079_925360084 25 Left 925360079 2:3272555-3272577 CCGGTTGATGGAGCATTCAAAAC 0: 1
1: 0
2: 16
3: 97
4: 276
Right 925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG 0: 2
1: 11
2: 79
3: 195
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925360084 Original CRISPR TCTTACATGGGCATGGTTCG TGG Intronic
900609464 1:3538371-3538393 GCTGACATTGGAATGGTTCGGGG - Intronic
901261117 1:7871783-7871805 TCTTATATGGGCACTGTTTGTGG - Intergenic
901949454 1:12730492-12730514 TCTTATATGGGTGTGGTTCGTGG + Intergenic
903561129 1:24228708-24228730 TATTATATGGGCCCGGTTCGTGG + Intergenic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
903881121 1:26510190-26510212 TCTTATATGGGCACAGTTTGTGG - Intergenic
904680947 1:32228800-32228822 TCTTACATGGTCATAGTTGGGGG - Exonic
905086213 1:35379884-35379906 TCTTACATTGACGTGGTTTGTGG + Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
906558889 1:46739132-46739154 TCTTATATGGGTGTGGTTCCTGG + Intergenic
907079446 1:51607940-51607962 TTATACATTGGCATGGTTCCAGG + Intronic
907610360 1:55863582-55863604 TCTTATATGGGCACAGTTCATGG - Intergenic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
910231755 1:84995099-84995121 TCTTATATGGGCACAGTTCATGG + Intronic
910365419 1:86460035-86460057 TTATACATTGGCATGGTTCCGGG + Intergenic
910545735 1:88415331-88415353 TCTTACATGAGCACAGTTCATGG + Intergenic
910746309 1:90578849-90578871 TCTTTCATGGGCTTGATTCTTGG - Intergenic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
911173509 1:94795466-94795488 TCTTAAATTGGCATGGTTTTAGG + Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911746330 1:101445543-101445565 TTATACATTGGCATGGTTCTGGG - Intergenic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
911955758 1:104232895-104232917 ACTTATATGGGCATAGTTCATGG + Intergenic
911968538 1:104399291-104399313 TGTTACATGGGCATACTTTGTGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
915305614 1:154975748-154975770 TCTTCCCTGGGCTTGGTTTGGGG + Intronic
916553147 1:165869127-165869149 TTTTATATGGGCGTGGTTGGTGG + Intronic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
917353277 1:174100698-174100720 TCTTACATAGTCATGGTTTGTGG + Intergenic
917353522 1:174102855-174102877 TCTTATATGAGCGTGGTTGGTGG - Intergenic
917950879 1:180034689-180034711 TCTTAAACGGACATGGTTGGTGG - Intronic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919123419 1:193368827-193368849 TCTTATACTGGCATGGTTTGTGG + Intergenic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
920799197 1:209172038-209172060 TCTTACATGGGCACAGTTCATGG - Intergenic
921276209 1:213523240-213523262 TCTTACATGGGCACAGTTTGTGG + Intergenic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
922279650 1:224111602-224111624 TCTTATATGGGTATGATTGGTGG + Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
923481317 1:234386970-234386992 TCTTACATGGGTACAGTTTGTGG + Intergenic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1062777233 10:162235-162257 TCTTACATAGGTGTGGTTTGTGG + Intronic
1063598399 10:7458267-7458289 TTTAACATGGTCATGGTTCACGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064404978 10:15053586-15053608 TTATACATTGGCATGCTTCGGGG - Intronic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1065410903 10:25426639-25426661 TCTTACATGGGTGAGGTTCATGG + Intronic
1066237935 10:33505133-33505155 TCTTAGATGGGCACAGTTTGTGG + Intergenic
1067548119 10:47211131-47211153 TCTTGTGTGGGCATGGTTCCTGG - Intergenic
1068243940 10:54340726-54340748 TTCTACATTGGCATGGTTTGGGG + Intronic
1068952979 10:62795921-62795943 TCATACATTGGCATGGTTCGGGG + Intergenic
1070315426 10:75306836-75306858 TCTTACAAGGGCGTGGTTCACGG - Intergenic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071054006 10:81487713-81487735 TCTAATATGGTCATGGTTCATGG - Intergenic
1071400847 10:85269056-85269078 TCTTACATGGGTACAGTTTGTGG + Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1072580825 10:96738991-96739013 TCTTATATGGGCACAGTTCTGGG - Intergenic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1075751302 10:124773673-124773695 TCTTACGTGGGCACAGTTCATGG + Intronic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1078193672 11:9115968-9115990 GCTTACATAGGCATGGTTTGTGG + Intronic
1078243260 11:9549978-9550000 TCTTGTATGGGCACGGTTTGTGG - Intergenic
1078784359 11:14473615-14473637 TTTTATATGGGAATGGTTCCTGG + Intronic
1079272452 11:19001004-19001026 TCTTTTATGGGCATAGTTTGTGG - Intergenic
1079343387 11:19631450-19631472 TCTTACATGGGCATTTTATGAGG - Intronic
1079643949 11:22840001-22840023 TCTTAAGTGGGTATGGTTCATGG + Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081212083 11:40348061-40348083 TGTTATATGGGCATGGATCACGG + Intronic
1081261551 11:40967660-40967682 TCTTATATGGGCATGATTTGTGG - Intronic
1081266171 11:41024998-41025020 TCTTATAAGGGCTTGGTTTGTGG - Intronic
1081434339 11:43010681-43010703 TTATACATTGGCATGGTTCTGGG + Intergenic
1081485743 11:43526853-43526875 TCTTATATGGGCACAGTTCGTGG + Intergenic
1082861865 11:57864379-57864401 TATTACATTGGCATGGTTCTGGG - Intergenic
1083487869 11:62994959-62994981 TCTGACGTGGGCATGGTCCAGGG + Intronic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1085436516 11:76509019-76509041 TCTTACACGAGCATGGTTTGTGG + Intronic
1085500508 11:77018286-77018308 TCTTCTATGTGCATGGTTTGTGG - Intronic
1086494948 11:87393293-87393315 TCTTATATGAGCCTGGTTCATGG - Intergenic
1086734262 11:90286156-90286178 TCTTTTATGGACATAGTTCGTGG + Intergenic
1086896977 11:92324532-92324554 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1087421933 11:97940046-97940068 TCTTTTATGGGCATGATTTGTGG - Intergenic
1087577510 11:100008085-100008107 TCTTCTATGGGCATAGTTCATGG + Intronic
1087609444 11:100416119-100416141 TCTTACACGGGCTTTGTTTGTGG + Intergenic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088439704 11:109856169-109856191 TCTTATGTGGGCATGATTCGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1089801433 11:121032239-121032261 ATTTACATGGGCATGTTTCTGGG + Intronic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1091352012 11:134905364-134905386 TCCTGCATGGGCTTGGCTCGAGG - Intergenic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091865186 12:3828019-3828041 TGTTATATGGGCATGTTTTGGGG - Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1093007617 12:14067657-14067679 TTATACATTGGCATGGTTCTGGG - Intergenic
1093252536 12:16825071-16825093 TCTTACATGGGCACAGATCATGG - Intergenic
1093435161 12:19128450-19128472 TCTTACATGGGCTCAGTTCATGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1093691166 12:22110818-22110840 TCTTACATGGGCACATTTCATGG + Intronic
1094250416 12:28353683-28353705 TCTGATATGGGCATGGTTTGTGG + Intronic
1095466960 12:42497584-42497606 TCTTATATGGGCACAGTTCATGG + Intronic
1095523075 12:43091578-43091600 TCTTATATGAGCATAGTTTGTGG - Intergenic
1095688130 12:45058966-45058988 TCTTATATGGGCACAGTTCTTGG + Intergenic
1096434864 12:51580997-51581019 CCTTGTATGGGTATGGTTCGTGG - Intergenic
1096886082 12:54720714-54720736 TTATACATTGGCATGGTTCTGGG + Intergenic
1097206509 12:57326064-57326086 TCTTACATGGGCACAGTTCCTGG - Intronic
1097453281 12:59763858-59763880 TCTTATATGGGCACAGTTCATGG - Intronic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1098427399 12:70380289-70380311 CCTCATATGGGCATGGTTTGTGG + Intronic
1098800728 12:74953985-74954007 TCTTATATGGGCATGTTTTCTGG + Intergenic
1099161997 12:79253398-79253420 TCTCATATGGGCATAGTTCTTGG - Intronic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100516446 12:95332860-95332882 TTTTATATGGGCTTGGTTTGTGG + Intergenic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101872347 12:108576467-108576489 TCTTACATGGGCACAGTTCGTGG + Intergenic
1102488920 12:113277130-113277152 TCTTCCAAGGGCAGGGTTCCTGG - Intronic
1104096522 12:125563063-125563085 TCTCACATAGGCATCGTTTGTGG + Intronic
1104395713 12:128430786-128430808 TCTTATATGGGCACAGTTCATGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1105393001 13:19999452-19999474 TCTCATATGGGTATGGTTTGTGG - Intronic
1105747018 13:23386939-23386961 TCTTATTTGGGCACAGTTCGTGG + Intronic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107806385 13:44157608-44157630 TTTTACATGGTCATGGTGAGGGG - Intronic
1109080499 13:57893725-57893747 TCTTATATGGGCACAGTTCATGG - Intergenic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109254706 13:60065019-60065041 TCTAACATGGGTGTGGTTTGTGG + Intronic
1109735411 13:66478185-66478207 TCTAATATGGGCATGGCTTGTGG - Intronic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109853886 13:68103396-68103418 TCTTATATGGGTATGGATTGTGG + Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110022023 13:70486875-70486897 TCTTACATTGCCATGGTTTGTGG + Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110300792 13:73924480-73924502 TCTTCTATGGGCAGGGTTCATGG - Intronic
1110766480 13:79285069-79285091 CCTTACATGGGTGTGGTTTGTGG - Intergenic
1111135420 13:84036342-84036364 TCATACATTGGCATGCTTCTGGG + Intergenic
1111163555 13:84427246-84427268 TCTTATATAAGCATGGTTCCTGG - Intergenic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1111936641 13:94564462-94564484 TCTTACATGGGCATGATATGCGG + Intergenic
1112521143 13:100096344-100096366 ACTTATATGGGCGTGGTTCACGG - Intronic
1112543864 13:100344963-100344985 CCTTACACGTGCATGGTTTGTGG - Intronic
1112556245 13:100471263-100471285 TCGTACATGGGCACAGTTTGTGG + Intronic
1112728795 13:102335905-102335927 TCTTACATGGGCACAGTTTGGGG - Intronic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1113535878 13:111065976-111065998 TTATACATGGGCATGGTTCAGGG - Intergenic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113695023 13:112339153-112339175 TCTTATATGGGCACTGTTTGTGG - Intergenic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1115627986 14:35214583-35214605 TCTTACATGGGTGTGGTTCCTGG + Intronic
1115803036 14:37017404-37017426 TTTTACATGTACATGGTTCATGG + Intronic
1117231239 14:53720975-53720997 TCTTATATGGGCACAGTTCGTGG - Intergenic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1117932304 14:60855853-60855875 TCTTATATGGGTGTGGTTCCTGG - Intronic
1118260603 14:64243259-64243281 GCTTATATGGGCATAGTTTGTGG + Intronic
1118553169 14:66980016-66980038 TCTTACATGGGCACCATTTGTGG + Intronic
1119179172 14:72593143-72593165 TCTTTCTTGGGCATGGTTGTGGG - Intergenic
1120264678 14:82233912-82233934 TTTTATATGGGCATGGTTTCTGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1120755386 14:88238981-88239003 TCTTCAAAGGGCATGGTTGGTGG + Intronic
1120832298 14:89008309-89008331 TCTTACATGGACCTGGGTAGAGG + Intergenic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121165568 14:91793649-91793671 TCTTATATAGGTGTGGTTCGTGG - Intronic
1121347534 14:93147154-93147176 GCTCACATGGGCATGGTGAGTGG + Intergenic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1123013829 14:105364000-105364022 TCTTACATGGGTGATGTTCGTGG + Intronic
1123406712 15:20023883-20023905 TTATACATTGGCATGGTTCTGGG + Intergenic
1123516042 15:21030531-21030553 TTATACATTGGCATGGTTCTGGG + Intergenic
1124461003 15:29891716-29891738 TCTTATATGGGCAGGGTTTGTGG - Intronic
1124901580 15:33828167-33828189 TCTTACAAGGGCATAGTTCATGG - Intronic
1125236764 15:37523756-37523778 TCTTAGATGAGTGTGGTTCGTGG + Intergenic
1125313606 15:38407609-38407631 TTTTACATGCGAATGGTTTGGGG - Intergenic
1125810477 15:42536090-42536112 TCTTATATTGGCATGGTTTGTGG + Intronic
1126049865 15:44675864-44675886 ACTTACTGGGGGATGGTTCGGGG - Intronic
1126885920 15:53149944-53149966 TCTTACATGAACATGATTTGTGG - Intergenic
1127025441 15:54800156-54800178 TCTTATATAGGCAAGGTTCGTGG - Intergenic
1127081438 15:55384255-55384277 TCTTTCATAGGCACGGTTCATGG + Intronic
1127447136 15:59075028-59075050 TCTTATATGGGCACAGTTCTTGG + Intronic
1127600383 15:60529979-60530001 TCTTAAATGGACAGGGTTCTAGG - Intronic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129499290 15:76020106-76020128 TCTTACACAGTCATGGTTCATGG - Intronic
1129948813 15:79567318-79567340 TCTTAGATGGGCATGGCTTGTGG - Intergenic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1130408158 15:83621493-83621515 TCTTATATAGGCATTGTTTGTGG + Intergenic
1131404433 15:92152787-92152809 ACTTACCTGGGGATGGTTCATGG - Intronic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132020676 15:98359251-98359273 TTATACATTGGCATGGTTCTGGG - Intergenic
1132032414 15:98449623-98449645 ACTTACACGGGCATGGTTTGTGG + Intronic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1133093812 16:3427144-3427166 AGTTACCTGGGCATGGTTGGGGG - Intronic
1134272994 16:12750528-12750550 CCTTAAATGGACATGGTTTGTGG + Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1136501538 16:30672466-30672488 TCTTACATGGGCACTGTTTGTGG + Intergenic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1139125900 16:64077031-64077053 TCTTATATGGGCACAGTTTGTGG - Intergenic
1140574681 16:76152798-76152820 TCTTATATGGGCATAGTACATGG + Intergenic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141304465 16:82848598-82848620 TCTTATATGGGCACAGTTTGTGG - Intronic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1142919024 17:3168257-3168279 TCTTACATGGGTGCAGTTCGTGG + Intergenic
1142922732 17:3205213-3205235 TCTTATATGGGCATGATTTGTGG - Intergenic
1142953035 17:3499663-3499685 TCTCACATGGGCACGATTCATGG - Exonic
1143184949 17:5004449-5004471 TCTTACAGGGTCATGGTCTGAGG - Intronic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1146042985 17:29474624-29474646 TCTTATATGGGCACAGTTCATGG + Intronic
1146158361 17:30543783-30543805 TCTTAGATGGGCACAGTTCATGG - Intergenic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1149290817 17:55216044-55216066 TTATACATTGGCATGGTTCTGGG - Intergenic
1149972050 17:61228656-61228678 TTTTACATGGGCATAGCTTGAGG - Intronic
1151027414 17:70694865-70694887 TCTTACATGGGTAGGGTTTGTGG - Intergenic
1151864204 17:76789264-76789286 TTATACATTGGCATGGTTCCGGG + Intergenic
1152978963 18:254778-254800 TCTTAGATGGGCACAGTTTGTGG - Intronic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153492887 18:5667801-5667823 TCTGTTATGGGCATGGCTCGTGG + Intergenic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1154392490 18:13952026-13952048 TCTTAGATGGGAGTGGGTCGTGG - Intergenic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155741197 18:29290327-29290349 TCTTATATGGGCAAGGTTTCTGG - Intergenic
1155809958 18:30219821-30219843 TCTTATATGGGCACAGTTTGTGG + Intergenic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156128310 18:33935493-33935515 TCTTAATTTGGCATGGTTCACGG + Intronic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1156851959 18:41738997-41739019 TCTTGAATGGGCACAGTTCGTGG - Intergenic
1157371853 18:47120895-47120917 CTTAACATGGGCATGGTTTGTGG + Intronic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1159700536 18:71621162-71621184 TGTTACATGGGTGTGGTTTGTGG + Intergenic
1159906275 18:74095560-74095582 TCTTACATGGGCACTGTCTGAGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1160520304 18:79504470-79504492 TCTTAGATGGGCACAGTTCGTGG + Intronic
1160552051 18:79700024-79700046 TCTTATGTGGGTGTGGTTCGTGG - Intronic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1167397590 19:49241389-49241411 TTTTATATGGGCATAGTTTGTGG + Intergenic
925200478 2:1964237-1964259 TCTTACACGGGCGCGGTTCCTGG + Intronic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
926057467 2:9782764-9782786 TCTTATATGGGCACGATTCATGG - Intergenic
926834842 2:17007067-17007089 TCTTATATAGGCATGGTTTCTGG - Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928264021 2:29794742-29794764 CCTTATAGGGGCATGGTTTGTGG + Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
930949574 2:57123098-57123120 TCTCAGAAGGGCATGGTTCGTGG + Intergenic
931327213 2:61239053-61239075 TCTTATATGGGTGTAGTTCGTGG - Intronic
931407941 2:61998913-61998935 TCTTCTATGGGCATGTTTCATGG + Intronic
931960957 2:67482364-67482386 TCTTATATGAGCATTGTTCATGG - Intergenic
932116756 2:69057530-69057552 TCTTACATGTGTGTGGTTTGTGG - Intronic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
932951033 2:76293821-76293843 TCTTACACGGGCATGATTCTTGG + Intergenic
933626734 2:84609587-84609609 TCTTATATAAGCATGGTTCATGG + Intronic
933896809 2:86818576-86818598 TCATAAATGGGCATGGTTCATGG - Intronic
933906250 2:86896465-86896487 TCTTATATGGGTACAGTTCGTGG - Intergenic
934058968 2:88276370-88276392 TCTCAAGTGGGCATGGTTCATGG - Intergenic
936005298 2:108881800-108881822 TCTTACATGGGTGTGGTTCTTGG + Intronic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936365916 2:111855217-111855239 TCTTATATGGGTACAGTTCGTGG + Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
938022554 2:127917933-127917955 TCTTATATGGGCACAGTTGGTGG + Intergenic
938174189 2:129109248-129109270 CCTTATATGGGCATGATTTGTGG + Intergenic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938621305 2:133057099-133057121 TCTTATATGGGCACGATTTGTGG - Intronic
938987237 2:136589290-136589312 TCTCATATAGGCATGGTTTGTGG + Intergenic
939577149 2:143909397-143909419 TTATACATTGGCATGCTTCGGGG - Intergenic
939653376 2:144791473-144791495 TCTTACATTGGTGTGGTTCATGG + Intergenic
939722739 2:145675200-145675222 TCTTAAATGGGCACGGTTTGTGG + Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
941016426 2:160362565-160362587 TCCTATATGGGAATGGTTTGTGG + Intronic
941077465 2:161022171-161022193 TCTTTTATGGGCATGGTGTGTGG - Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
941733020 2:168939947-168939969 TCTTATATTGGCGTGGTTCGTGG - Intronic
941801874 2:169668746-169668768 TCTTATATGGGTACAGTTCGTGG + Intronic
942050744 2:172138442-172138464 GTTTATATGGGCATGGTTCTTGG - Intergenic
942833193 2:180261533-180261555 TCTTATATGGGTGTGGTTCTTGG + Intergenic
942876851 2:180810840-180810862 TCTTATATGGGCAAGGTTTGTGG - Intergenic
943247004 2:185467459-185467481 TCTTAAAGGGGCATAGTTCATGG + Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944273949 2:197814388-197814410 TATTATATGGGCATAGTTCATGG - Intronic
944623034 2:201538629-201538651 TCTTAGATGGGTGTGGTTTGTGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
945346116 2:208718777-208718799 TCTTATATGGGCACAGTTCATGG + Intronic
945392025 2:209276133-209276155 TTATACATTGGCATGGTTCCAGG - Intergenic
945830211 2:214775435-214775457 TGTTACATGGCCAGGGTTTGTGG + Intronic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947051195 2:226045373-226045395 TTATACATTGGCATGGTTCCGGG - Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
947554022 2:231073172-231073194 TTTTATATGGGTGTGGTTCGTGG + Intronic
947555423 2:231088597-231088619 TTTTACATGGGTGTGGTTCGTGG - Intronic
947786297 2:232824034-232824056 CCTTACATGGGCACAGTTCACGG - Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
1169313922 20:4572177-4572199 TCTTACTTGGGATTGGTTCAAGG - Intergenic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1169750797 20:8991349-8991371 TCTTTTATGGGCATGGGTCTTGG + Intergenic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171236695 20:23532856-23532878 ACTTATATGGTCATGGTTCTTGG + Intergenic
1171313163 20:24162417-24162439 TCTCACATGGGTGTGGTTTGTGG - Intergenic
1172131909 20:32661584-32661606 TCTTCCTTGGGCCTGGTTCTGGG + Intergenic
1172257763 20:33534814-33534836 TCTTATATGGGCACAGTTTGTGG + Intronic
1173910714 20:46667964-46667986 TCTTATATGGGCACAGTTCATGG - Intronic
1173942087 20:46920033-46920055 TCTTATATGGGCACAGTTTGTGG + Intronic
1174650527 20:52121023-52121045 TCTTACATGGGCACAGTTCATGG - Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1175168030 20:57059944-57059966 TCTTATACGGGCACAGTTCGTGG + Intergenic
1175173651 20:57096508-57096530 TGTGACATGGGCATGGGTCATGG - Intergenic
1175768550 20:61607993-61608015 TCTAACAAGGGCAGGGTTCTAGG - Intronic
1176311345 21:5152176-5152198 TCTTACATGGGCACGGATCACGG + Intronic
1177335717 21:19723465-19723487 GCTTATATGGGCATGGTTTGTGG + Intergenic
1177654639 21:24002184-24002206 TCTTATATGGGCACAGTTTGTGG - Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178089330 21:29144588-29144610 TCTTACATGGCCACGAATCGTGG + Intronic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1179772038 21:43627970-43627992 TCTTACATGGGTGTGGCTCATGG - Intronic
1179845705 21:44109859-44109881 TCTTACATGGGCACGGATCACGG - Intronic
1179915522 21:44475536-44475558 TTATACATTGGCATGGTTCCGGG - Intergenic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180848870 22:19000846-19000868 TCTTATATGGGCACAGTTCATGG + Intergenic
1180878980 22:19190390-19190412 TCTTATAGGGGCATGGTTTGTGG + Intronic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1181664064 22:24378758-24378780 TCTTATATGGGCACAGTTCATGG + Intronic
1182074052 22:27482907-27482929 TCTTGCCTGTGCATGGTGCGAGG + Intergenic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1183267992 22:36841697-36841719 TCTTACATAGTCATGGCTCATGG - Intergenic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
949438374 3:4053276-4053298 TCTTTTATGGACATGGTTCGTGG + Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949813554 3:8034188-8034210 CTTTATATGGGCATGGTTTGTGG + Intergenic
949984663 3:9531106-9531128 TCTTACATGGGCGCAGTTCATGG + Intronic
950112654 3:10429508-10429530 TCTGATATGGGCATGGTTTGTGG - Intronic
950632407 3:14291514-14291536 TCTTACATGGGCACAGTTCATGG - Intergenic
950780364 3:15386528-15386550 TTATACATGGGCATGGTTCCAGG + Intronic
951333039 3:21388168-21388190 TCTTACATGGGCACAGTTAATGG - Intergenic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951756961 3:26101650-26101672 TTTTACATTGGCATGCTTCCTGG + Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
953790064 3:45940583-45940605 TTATACATTGGCATGGTTCCAGG - Intronic
955211150 3:56942428-56942450 TCTTATATGAGGATGGTTCGTGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955678306 3:61472719-61472741 CCTTATATGGGCATGATTTGTGG + Intergenic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
956960612 3:74395973-74395995 TCTTACATGAGCAGGGTTCATGG - Intronic
957627060 3:82666781-82666803 TCTTATATGGGCAAAGTTCCTGG + Intergenic
957782914 3:84842777-84842799 TCTTACATGGGTGTGGTTTGTGG - Intergenic
957863734 3:85994795-85994817 TCCTATATGAGCATGGTTTGTGG + Intronic
958421458 3:93936356-93936378 TGTTACATGGGCATATTACGTGG - Intronic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959031241 3:101301150-101301172 TCTTACATGGATATTGTTCATGG + Intronic
959059436 3:101602856-101602878 TCTTACATGGGCAGAGTGGGAGG + Intergenic
959585593 3:108022339-108022361 TCATACATTGACATGGTTCCAGG + Intergenic
959681460 3:109101268-109101290 TCTCACATGGGCCTGGTTAAGGG - Intronic
959721704 3:109498103-109498125 TCTCATATGGGCCTGGTTCATGG + Intergenic
959821219 3:110737541-110737563 TCTCATATGGAGATGGTTCGTGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
960351196 3:116595197-116595219 ACTTACATGGGAATGGCTGGAGG - Intronic
960476386 3:118134543-118134565 TCTTACATGGGTGAGGTTTGTGG - Intergenic
960794040 3:121465702-121465724 TCTTACATGAGTGTGGTTCATGG - Intronic
961092142 3:124122654-124122676 TTTTATATGGGCATGGTTTGTGG - Intronic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963183845 3:142391003-142391025 TCTCAAATGGGCATGGTTGATGG + Intronic
963195217 3:142520154-142520176 TCTTATATGGGCACAGTTTGTGG - Intronic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963746719 3:149131523-149131545 TCTCACATGGGCACAGTTCATGG - Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964617009 3:158677156-158677178 TCTTATATGGGCAGGTTTCATGG - Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965831267 3:172792106-172792128 TCTCATATGGGCATTGTTAGTGG + Intronic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
965996034 3:174884244-174884266 TCTTTCATGGCCAGGGTTCATGG - Intronic
965998771 3:174920979-174921001 TCTCACATGGTCATGGTCCATGG + Intronic
966214336 3:177486490-177486512 TCTTATATGGGCACAGTTCATGG + Intergenic
966663676 3:182446208-182446230 TCTTATACAAGCATGGTTCGTGG - Intergenic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970605391 4:17676327-17676349 TCTTCTACGGGCATGGTTTGTGG + Intronic
970629793 4:17927720-17927742 TCTCATATGGGAGTGGTTCGTGG + Intronic
971016746 4:22496871-22496893 TCTGTCATGGGCATGGTATGGGG - Intronic
971086080 4:23276702-23276724 TCTTACAAGGGCACAGTTCATGG - Intergenic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
971477907 4:27089583-27089605 TCATACATTGGCATGGTTTTGGG + Intergenic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971709065 4:30088079-30088101 TCTCATATGGGCATGGTTTGTGG + Intergenic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
972912194 4:43831203-43831225 TTGTACATTGGCATGGTTCCAGG - Intergenic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
973658388 4:53075734-53075756 TCTTACATGGGGGTAGTTCATGG + Intronic
974039215 4:56843550-56843572 TTATACATTGGCATGGTTCTGGG - Intergenic
974316227 4:60284711-60284733 TCTTATATGGGCACAGTTTGTGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975124923 4:70771038-70771060 TCTTATATGGGCGTAGTTCATGG + Intronic
975222857 4:71833343-71833365 TTATACATTGGCATGGTTCCGGG + Intergenic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975478282 4:74847931-74847953 TCTTATATAGGCATGATTCATGG - Intergenic
975567884 4:75779095-75779117 TCTTATATGGGCACTGTTTGTGG - Intronic
975916411 4:79330992-79331014 TTATACATTGGCATGGTTCAGGG - Intergenic
976154457 4:82127602-82127624 TCTTATATGGGCTAGGTTCCTGG - Intergenic
976223380 4:82776082-82776104 TCTTACATGGGCTTTGGTGGAGG - Intronic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977356059 4:95948320-95948342 TCTTATATGGGCACAGTTTGTGG + Intergenic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977582883 4:98744587-98744609 TTATACATTGGCATGGTTCCAGG + Intergenic
977715132 4:100173612-100173634 TCTCATATGGGTGTGGTTCGTGG + Intergenic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980549720 4:134318853-134318875 TCTTATATGGGCATAGTTTGTGG + Intergenic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981439359 4:144765533-144765555 TCCTACACAGGCATGGTTCATGG + Intergenic
981464422 4:145051307-145051329 TATTATATGAGCATGGTTCATGG + Intronic
981493002 4:145361112-145361134 TCTTACATGGGTGTGGTTTGTGG - Intergenic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
981984784 4:150840575-150840597 TCTTAAATGGGTGTGGTTTGTGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982085122 4:151827347-151827369 TCTTACATGAGCATGTTTCATGG + Intergenic
982344650 4:154344122-154344144 TCTTTCATGGCCATGGTTTGTGG + Intronic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
983058260 4:163125048-163125070 TATTATATGGGCATAGTTCATGG - Intronic
983086710 4:163454016-163454038 TCTTATACGGGCATGGTTTGTGG + Intergenic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983652889 4:170051231-170051253 TCTTACAGGGGCACAGTTCATGG + Intergenic
983808595 4:172027437-172027459 TCTTACAAGGGCACAGTTTGTGG - Intronic
984104711 4:175530900-175530922 TCTTACGTGGGCACAGTTCTTGG + Intergenic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984436542 4:179717529-179717551 TTTAACATTGGCATGGTTCTGGG - Intergenic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
984822947 4:183899125-183899147 TCTTATATGGGCACACTTCGTGG - Intronic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
985905237 5:2830194-2830216 TGCTACATGGGCCTGGTTGGGGG - Intergenic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987726654 5:21709324-21709346 TCTTATATGGGCACAGTTCATGG - Intergenic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988669778 5:33368912-33368934 TTTTATAGGGGCATGGTTTGTGG + Intergenic
988704412 5:33710297-33710319 TCTTATATGGCAATGGTTGGAGG - Intronic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
989001096 5:36761596-36761618 TCTTATACAGGTATGGTTCGTGG + Intergenic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
989762047 5:45027569-45027591 TCTTACGTGGGCATGCTTCATGG - Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
990979388 5:61588145-61588167 TCTTATATGGGCAGGTTTCATGG - Intergenic
991171618 5:63633144-63633166 TCTTACATGGATATGGTTCATGG + Intergenic
991394132 5:66185660-66185682 TCTTATATGGGCACGGTTTGTGG - Intergenic
992362956 5:76061048-76061070 TCTTATATGGGCATAGTTTGTGG + Intergenic
992918353 5:81483099-81483121 TCTTGTATGGGCACGGTTTGTGG + Intronic
993082121 5:83314742-83314764 TATTTTATGGGCATGGTTTGTGG - Intronic
993124338 5:83814090-83814112 TCTTATATGGGCACTGTTTGTGG + Intergenic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994281418 5:97908000-97908022 TTATACATTGGCATGGTTCTGGG - Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994628730 5:102254473-102254495 TCTTAAAGGGGCATGGTTCATGG - Intronic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996398822 5:123037387-123037409 TCCTACATGACCATGGTTCTGGG - Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
997162904 5:131627933-131627955 TCTTACATGGGCACAGTTTGTGG - Intronic
997176201 5:131780684-131780706 TCTTATATGGGCACAGTTCCTGG - Intronic
997274305 5:132571088-132571110 TCTTATATGTGGATGGTTTGTGG + Intronic
998863646 5:146472493-146472515 TCTTACATGGGTGTGGTTTGTGG - Intronic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1000453800 5:161423564-161423586 TCTTATATGGACATGCTTCGTGG - Intronic
1000821259 5:165987190-165987212 TCTTATATGGGCATGCTTTGTGG - Intergenic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1002813092 6:653052-653074 TCTCATATGAGCATGGTTTGTGG - Intronic
1003275070 6:4643442-4643464 TCTTCTATGGGCATAGTTCGTGG + Intergenic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1003706081 6:8531939-8531961 TCTTATATGGGCACAGTTCATGG - Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1003950567 6:11111751-11111773 TTATACATCGGCATGGTTCCGGG + Intronic
1004371593 6:15057344-15057366 TCTTATATGGGCGTAGTTCATGG + Intergenic
1004658157 6:17684903-17684925 TCTTATATGGGTGTGGCTCGTGG + Intronic
1004972229 6:20923501-20923523 TCTCATATGGGCATAGTCCGTGG - Intronic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1005621363 6:27623568-27623590 TTATACATTGGCATGGTTCCGGG + Intergenic
1005689879 6:28293716-28293738 TTTTAAACGGGCATGGTTTGTGG - Intronic
1005703317 6:28426485-28426507 TCTTATATGGGTGTGGTTAGCGG + Intergenic
1006407215 6:33852252-33852274 TCCCACATGGGCGTGGTTAGGGG - Intergenic
1007565897 6:42850115-42850137 ACTTACATGTGAATGGTTGGTGG + Intronic
1007884227 6:45207735-45207757 TTTTATATGGGCCTGGTTCTTGG - Intronic
1008152267 6:47968288-47968310 TCTTACATGGGTGTGGTTTGTGG + Intronic
1008268921 6:49466199-49466221 TCTGATATTGGCATGGTTCATGG + Intronic
1009240521 6:61180608-61180630 TCTTACATAGGTATGGTTTCTGG - Intergenic
1009346286 6:62615718-62615740 TTTTACATTGGCTTGGTTCCAGG + Intergenic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010064796 6:71669742-71669764 TCTTATATGTGCATGGGTCATGG - Intergenic
1010608478 6:77921837-77921859 TCTGATATGGGCATGGTTTGTGG + Intronic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1010724600 6:79318995-79319017 CGTCACATGGGCATGGTTTGTGG + Intergenic
1012304525 6:97636443-97636465 TCTTCTATAGGCATGGTTCGTGG - Intergenic
1012493671 6:99811021-99811043 TTGTACATTGGCATGGTTCCAGG + Intergenic
1012716068 6:102672111-102672133 TTATACATTGGCATGGTTCTAGG + Intergenic
1012983317 6:105852256-105852278 TCTTATATGGGCACAGTTTGTGG + Intergenic
1013088826 6:106880546-106880568 TCTTACATGAGTGTGGTTTGTGG + Intergenic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013729760 6:113151265-113151287 TCTTATATGGGCATGACTTGTGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013943575 6:115695258-115695280 TTTTATATGGGCATGGTTTGTGG - Intergenic
1014076404 6:117240445-117240467 TCTTATATAGGCATGGTTTGTGG - Intergenic
1014528296 6:122527619-122527641 TTTTATATGGGAATGGTTTGTGG + Intronic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1015433407 6:133156432-133156454 TCTTACATGGGCACAGTTTGTGG + Intergenic
1016081599 6:139863928-139863950 TCTTATATGGGCACAGTTTGTGG - Intergenic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016847995 6:148587968-148587990 TCTTATCTGAGCATGGTTGGTGG - Intergenic
1016890354 6:149000214-149000236 TCTTATAAGGGCATAGTTCCAGG - Intronic
1016946161 6:149536140-149536162 TCTTATATGGGCACAGTTTGTGG - Intronic
1017298289 6:152825653-152825675 TCTTACGTGGGCACAGTTCATGG + Intergenic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1018294747 6:162333547-162333569 TTTTATATAGGCATGGTTGGTGG - Intronic
1018843753 6:167539535-167539557 TCTTACATGGGTGTGGCTCATGG + Intergenic
1019159495 6:170059606-170059628 TCTTACATGGATGTGGTTTGTGG - Intergenic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020523276 7:9222690-9222712 TCTTATATGGGCGTGATTCATGG - Intergenic
1020764452 7:12302868-12302890 TTATACATTGGCATGGTTCCAGG - Intergenic
1020833326 7:13118369-13118391 TCTAACATGGCCATGGTTCATGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021267980 7:18548234-18548256 TCTTATATGGGTGTGGTTCGTGG + Intronic
1021285379 7:18775132-18775154 TCTTATATGGGCACGATTCATGG + Intronic
1022365748 7:29714312-29714334 TCTTACTTGGGAATGGCTCAGGG - Intergenic
1022951366 7:35341348-35341370 TCTTATATGGGCACAGTTTGTGG - Intergenic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1023193494 7:37609242-37609264 TTGTACATGAGCATGGTTTGTGG - Intergenic
1024016829 7:45324952-45324974 TTATACATTGGCATGGTTCCAGG - Intergenic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1026482770 7:70792960-70792982 TCTTACACGGGCTGGGTTCGAGG - Exonic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1027526413 7:79274909-79274931 TATCATATGGGCATGGTTCATGG - Intronic
1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG + Intronic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028675220 7:93452117-93452139 TTTTACATGGGCATCTTGCGTGG - Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1029378124 7:100194452-100194474 TCTTATATGGGCACGGTTTGTGG + Intronic
1029463067 7:100707317-100707339 TCTTACATGGCTCTGGTCCGAGG - Exonic
1029499356 7:100918437-100918459 TTATACATTGGCATGGTTCCGGG - Intergenic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030479130 7:110080250-110080272 TTTTATATGGGCACGGTTTGTGG + Intergenic
1030483686 7:110138346-110138368 TCTTAAGTGTGCATGGTTCATGG - Intergenic
1030567714 7:111180446-111180468 TCTTACATGGGTGAGGTTTGTGG + Intronic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031878366 7:127167655-127167677 TTTTATATGGGCACAGTTCGTGG - Intronic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032701597 7:134385099-134385121 TCTTACATGGGCACAGTCCATGG - Intergenic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1032927773 7:136628699-136628721 TCTTGCATGGGCACAGTTTGTGG - Intergenic
1033107574 7:138542430-138542452 TCTTACATGGGTGTGGTTTGTGG + Intronic
1033112509 7:138593776-138593798 TCTTACATGAGTGTGGTTAGTGG + Intergenic
1033140865 7:138825211-138825233 TGTTCTATGGGCATGGTTCATGG - Intronic
1033388417 7:140902289-140902311 CCTTATATGGGTGTGGTTCGTGG - Intronic
1033446635 7:141428688-141428710 TTATACATTGGCATGGTTCCAGG - Intronic
1033795276 7:144838292-144838314 TCTTATAAGGGCATGGCTGGTGG - Intergenic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1034404446 7:150892910-150892932 TCTTACACGGGCATGGCTCACGG - Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1035167124 7:156998165-156998187 TCTTATATGGGCAAGGTTTGTGG + Intronic
1035387075 7:158480311-158480333 TCTTCTATGGGCACGGTTCATGG - Intronic
1036013950 8:4759562-4759584 CCTGACAGGGGGATGGTTCGGGG - Intronic
1037191741 8:16134446-16134468 TCTTTTACGGGCATGGTTTGTGG - Intronic
1037327835 8:17711967-17711989 TCTTAGATGAGCATGGTCCATGG + Intronic
1037447696 8:18983656-18983678 TCTTACATGGACACAGTTCTTGG + Intronic
1038526891 8:28282462-28282484 TCTTCCATGGGCACGGTTTGTGG - Intergenic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1040754030 8:50748780-50748802 TCTTATATGGGCACAGTTCATGG - Intronic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1041409754 8:57540607-57540629 TCATACATTGGCATGCTTCTGGG + Intergenic
1042029915 8:64464697-64464719 TCTTACATGGCCATGGTGGCAGG + Intergenic
1042140417 8:65673298-65673320 TCTTACATGTGCTTGGTTCATGG + Intronic
1042396438 8:68296412-68296434 TTTTACATTGGCATGGTTCCAGG - Intergenic
1042409843 8:68451653-68451675 TCTTACATGGGTGTGGTTTGTGG + Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042882423 8:73508438-73508460 TCTTATATGGGCATGATTTGTGG + Intronic
1043098999 8:76016115-76016137 TCTTATATGGGAATAGTTTGTGG - Intergenic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043990891 8:86752662-86752684 TCTTATATGGGCATAGTTTGTGG + Intergenic
1044030897 8:87235590-87235612 TCTTATATGTGCATAGTTTGCGG + Intronic
1044114304 8:88315564-88315586 TCTTAAATGGGCAGAGTTTGTGG - Intronic
1044139944 8:88637759-88637781 TCACACATTGGCATGGTTCTGGG - Intergenic
1044289506 8:90451265-90451287 TCTTACGTGAGCATGGTTTTTGG + Intergenic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044807729 8:96025396-96025418 TCTTATATGGGTAGGGTTTGTGG - Intergenic
1044889521 8:96818299-96818321 TCTTACATGGGTGTAGTTCGTGG + Intronic
1045399813 8:101802222-101802244 TATTTTATGGGCATGGTTTGTGG - Intronic
1047106512 8:121736791-121736813 TCTTCTATGGGCATAGTTTGTGG + Intergenic
1047178196 8:122562000-122562022 TCTTAAATAGGCACTGTTCGTGG + Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048943271 8:139421315-139421337 TCTTACATGGCCGTGGTTCATGG + Intergenic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051123744 9:13780308-13780330 TCTTATATGGGCAACGTTCATGG - Intergenic
1051179095 9:14391742-14391764 TTATACATTGGCATGGTTCCAGG - Intronic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051723776 9:20067467-20067489 TCTTACATGGGTATGCTCCCAGG + Intergenic
1051753568 9:20370318-20370340 TCTTACATGGGTGCGGTTTGTGG - Intronic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1051770764 9:20576626-20576648 TCTTATATGGGCACGCTTCATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052060474 9:23954450-23954472 TACTACATGGGAATGGTTCATGG - Intergenic
1052111336 9:24586809-24586831 TCTTACATGGGCACGGTTACTGG + Intergenic
1053296470 9:36917950-36917972 TCTTATATGGGCACAGTTTGTGG - Intronic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056227201 9:84507315-84507337 TCTTATATGTGCATGGCTTGTGG - Intergenic
1056274276 9:84977952-84977974 TCTTACATGGATATAGTTTGTGG - Intronic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058196361 9:101981725-101981747 TCTTATATGGGCACAGTTCATGG - Intergenic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059264747 9:113016623-113016645 TCTTATATGTGCATGGTCTGTGG - Intergenic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1186321927 X:8437090-8437112 TTTTACAATGGCATGGTTCAGGG + Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1188091895 X:25974954-25974976 TTATACATTGGCATGGTTCCAGG - Intergenic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188291452 X:28393695-28393717 TCTTGTATGTGCATGGTTTGTGG + Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1189930869 X:46008395-46008417 TCTTATATGGGCATTGTTTGTGG + Intergenic
1190141940 X:47854720-47854742 TCTTCTATGCGCATGGTTCGTGG + Intronic
1190460827 X:50672133-50672155 TCTTATATGGGCACAGTTTGTGG + Intronic
1190715729 X:53101647-53101669 TCTTACATGGGTACAGTTCATGG + Intergenic
1190949028 X:55123990-55124012 TTATACATTGGCATGGTTCTGGG + Intronic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1191957784 X:66664951-66664973 TGTCATATGGGCATGGTTTGTGG + Intergenic
1192028745 X:67485981-67486003 TCTTACATTGGCATGAGTTGTGG + Intergenic
1192230355 X:69260389-69260411 TCCTGCATGGGCATGATTGGTGG - Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1192606556 X:72524959-72524981 TTTTCCATGGGCATGGTTGGGGG + Intronic
1193055918 X:77150301-77150323 TCTTATATGGGTGTGGTTCTTGG + Intergenic
1193286533 X:79721494-79721516 TTATACATTGGCATGGTTTGGGG - Intergenic
1193396137 X:80985755-80985777 ACTTACATGGACACGGTTCGTGG + Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1194100510 X:89697422-89697444 TTTTACATGGGTATGGTTTGTGG + Intergenic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1194940208 X:100000104-100000126 TCTTAAAAAGGCATGGTTTGTGG - Intergenic
1195338729 X:103883445-103883467 TCTTATATGGGCACAGTTCATGG - Intergenic
1195593332 X:106657761-106657783 TCTCACATGGGTGTGGTTTGTGG + Intronic
1195628394 X:107028474-107028496 TCTTATATGGGCATAGTTTGTGG + Intergenic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196564041 X:117183726-117183748 TCTTACATAGGCATGGTTGGTGG - Intergenic
1196578043 X:117343969-117343991 TCTTATCTGGGTGTGGTTCGTGG + Intergenic
1197114047 X:122810968-122810990 TCTTATAAGGGCATGGTCCATGG - Intergenic
1197444172 X:126528183-126528205 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199103011 X:143827911-143827933 TTTTATATGGGCATAGTTTGTGG - Intergenic
1199343756 X:146714126-146714148 TCGTATATGGGCATGTTTCAGGG - Intergenic
1199359239 X:146898342-146898364 TCTTACATAGGCGTGGTTTGTGG - Intergenic
1199971030 X:152861342-152861364 TCTTACATGGGCCTGTTCCCAGG + Intronic
1200453462 Y:3358483-3358505 TTTTACATGGGTATGGTTTGTGG + Intergenic
1200635054 Y:5641589-5641611 TCTTATCTGGGCCTGGTTTGTGG + Intronic