ID: 925360676

View in Genome Browser
Species Human (GRCh38)
Location 2:3278277-3278299
Sequence CACCACATGCAGACTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 135}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925360671_925360676 -2 Left 925360671 2:3278256-3278278 CCCATCAGCTGCTGCCATCCACA 0: 1
1: 0
2: 0
3: 30
4: 261
Right 925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 135
925360667_925360676 11 Left 925360667 2:3278243-3278265 CCCTGCATCCTGCCCCATCAGCT 0: 1
1: 0
2: 6
3: 27
4: 349
Right 925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 135
925360670_925360676 -1 Left 925360670 2:3278255-3278277 CCCCATCAGCTGCTGCCATCCAC 0: 1
1: 0
2: 2
3: 31
4: 309
Right 925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 135
925360665_925360676 21 Left 925360665 2:3278233-3278255 CCACCTGCATCCCTGCATCCTGC 0: 1
1: 0
2: 6
3: 77
4: 674
Right 925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 135
925360668_925360676 10 Left 925360668 2:3278244-3278266 CCTGCATCCTGCCCCATCAGCTG 0: 1
1: 1
2: 4
3: 41
4: 360
Right 925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 135
925360666_925360676 18 Left 925360666 2:3278236-3278258 CCTGCATCCCTGCATCCTGCCCC 0: 1
1: 0
2: 5
3: 79
4: 775
Right 925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 135
925360672_925360676 -3 Left 925360672 2:3278257-3278279 CCATCAGCTGCTGCCATCCACAC 0: 1
1: 1
2: 3
3: 45
4: 338
Right 925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 135
925360669_925360676 3 Left 925360669 2:3278251-3278273 CCTGCCCCATCAGCTGCTGCCAT 0: 1
1: 0
2: 1
3: 34
4: 461
Right 925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG 0: 1
1: 0
2: 0
3: 21
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925360676 Original CRISPR CACCACATGCAGACTGTGGT TGG Intronic
903233384 1:21935265-21935287 CACCACCAGCAGCCTGGGGTGGG + Intronic
905252213 1:36656774-36656796 CACCACATTCGCACTGTGCTGGG - Intergenic
907388013 1:54138364-54138386 CTCCACATGCAAGCTGGGGTGGG - Intronic
908854482 1:68409164-68409186 CTCCACATACAGACAGTGGTGGG - Intergenic
912459805 1:109823031-109823053 AAGGACATGCAGAATGTGGTGGG + Intergenic
912916376 1:113818843-113818865 CGCCACATGCAGACTGTAGGTGG - Intronic
916791210 1:168126837-168126859 CTCCACATGCAGAGTGCTGTTGG - Intronic
917679215 1:177349204-177349226 CACCACGCCCAGACTGTGCTTGG - Intergenic
918443235 1:184589853-184589875 CATCACATGCAGAGTGATGTGGG - Intronic
922790500 1:228308400-228308422 CACCCCATGCAGTCACTGGTGGG - Intronic
922871417 1:228904972-228904994 CACCTTATCCAGACTGTGGTAGG + Intergenic
1064624298 10:17246633-17246655 TACCACATGCAGTCATTGGTTGG + Intergenic
1070589146 10:77789215-77789237 CCCCACATGGAGACTGTGCTGGG - Intergenic
1071061015 10:81570892-81570914 CAACCCATGCAGCCTGGGGTGGG + Intergenic
1071905757 10:90171920-90171942 CACCACTTGCAGGATGGGGTGGG - Intergenic
1074218798 10:111415393-111415415 CACACTCTGCAGACTGTGGTGGG + Intergenic
1075492348 10:122882430-122882452 TACCAGATACAGACTGTAGTAGG + Intergenic
1077036045 11:494972-494994 CAGCTCACGCAGGCTGTGGTTGG + Exonic
1077370454 11:2179416-2179438 CACAAGATGCAGACTCTGGGAGG + Intergenic
1083592308 11:63902941-63902963 CACCTGAAGCAGACAGTGGTAGG - Intronic
1085126398 11:74005421-74005443 CACCACAGGCAGGATGTGGTAGG - Intronic
1086106995 11:83157304-83157326 CACCACATGCTGACCGCGGAGGG - Exonic
1086934569 11:92730661-92730683 TCCCACATGGAGACTGGGGTTGG - Intronic
1087153830 11:94882119-94882141 TTCCACATGCAAACTTTGGTGGG - Intergenic
1101159979 12:101963886-101963908 CACCACGTGTTCACTGTGGTGGG + Intronic
1101653247 12:106696322-106696344 CCCCACATGCTGCCTGTGCTGGG + Exonic
1104883205 12:132086437-132086459 CACCACATGCTGACTCTGTAAGG - Intronic
1105323124 13:19346238-19346260 CACCGCATGCAGGCTGTGGCCGG + Intergenic
1106148370 13:27073101-27073123 CACCACATGGAGACTGAGGCTGG + Intronic
1107001918 13:35557482-35557504 CAGAGCATGCAGACTCTGGTGGG + Intronic
1111250373 13:85593465-85593487 AACTACATGCAGCCTGTGGCAGG - Intergenic
1112185498 13:97124398-97124420 CACCACATGCAGGAGTTGGTGGG - Intergenic
1112998980 13:105610148-105610170 CCCAACATGGAGACTGTGCTGGG + Intergenic
1113070143 13:106412314-106412336 CACCACAGGCTGAGTGTGGAAGG - Intergenic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113442066 13:110336866-110336888 CACCACATTCAGCCTGGGGCTGG + Intronic
1113855522 13:113443359-113443381 CAGCACTTGGAGACTGAGGTGGG + Intronic
1117235523 14:53770352-53770374 CACCACATGCAGGCGGTTTTAGG + Intergenic
1120456347 14:84735879-84735901 TAACAAATGCAGAATGTGGTGGG + Intergenic
1120935133 14:89888286-89888308 CACCATATGAAGACTGTAGTAGG + Intronic
1122341333 14:101030405-101030427 CACCACATGCTGACTGCAGGAGG + Intergenic
1125782281 15:42280440-42280462 GACCACATGCAAACAGTGGTTGG - Intronic
1126731607 15:51689051-51689073 CACCACATGCTGGCTGTTATAGG - Intronic
1128328906 15:66742959-66742981 CACCACATGCTAACTGTGGAAGG - Intronic
1129750507 15:78059581-78059603 CACCTCAAGCAGAATGTGGATGG - Intronic
1132034419 15:98469379-98469401 CACCACAAACAGACTAAGGTGGG + Intronic
1132465650 16:76325-76347 CACCGCTTCCAGCCTGTGGTGGG + Intronic
1132935479 16:2478408-2478430 CACCCCATGCAGAGTGTGGAGGG + Intronic
1137705804 16:50535062-50535084 CTTCCCATCCAGACTGTGGTTGG + Intergenic
1140327404 16:74018198-74018220 CACCACATGCAGACAATTTTTGG + Intergenic
1141054292 16:80802842-80802864 CACCCCCTGCAGTCTGTCGTGGG + Intronic
1147639271 17:41984693-41984715 TACCAATTGAAGACTGTGGTAGG + Intronic
1151094953 17:71486376-71486398 TAGAACATTCAGACTGTGGTAGG - Intergenic
1151730863 17:75910362-75910384 CTCCACAGGTAGACTGTTGTGGG - Intronic
1152381268 17:79943434-79943456 CACCACATGCTGACAGCGGACGG + Intronic
1153027696 18:686575-686597 CACCACATCCAGACACTTGTAGG + Intronic
1153909647 18:9695792-9695814 CACCACACACAGTCTGTGGCTGG + Intergenic
1154501183 18:14998763-14998785 CACCACTTGCAGGGTGCGGTAGG + Intergenic
1154930441 18:20989430-20989452 CAACACATCCAGACTGTAGTAGG + Intronic
1157319839 18:46625579-46625601 GGCCACATGCAGCCTGTGGGTGG + Intronic
1158868211 18:61658536-61658558 CACCAAATGCAGGCGGTGGTGGG + Intergenic
1161063080 19:2224944-2224966 GACCCCATGCAGTGTGTGGTTGG + Intronic
1163101481 19:15099834-15099856 GGCCACATGCAGCCTGTGGGTGG + Intergenic
1163448959 19:17364371-17364393 CACCACACCCAGCCTGGGGTGGG + Intronic
1164804633 19:31107373-31107395 CCCCACATGAAGAGTGTGCTTGG - Intergenic
1165355809 19:35303210-35303232 CACCACGCGCAGCCTGGGGTGGG + Intronic
925360676 2:3278277-3278299 CACCACATGCAGACTGTGGTTGG + Intronic
926450864 2:13002160-13002182 TAGCACATGCAGGGTGTGGTTGG + Intergenic
927761894 2:25764525-25764547 GGCCACATGCAGCCTGTGGTGGG + Intronic
929480460 2:42302488-42302510 AATCACATGAAGAATGTGGTCGG - Intronic
929524323 2:42686398-42686420 CACCACAGGCTGGGTGTGGTGGG + Intronic
931274255 2:60730382-60730404 CAACACAGGCAGGCTGAGGTGGG + Intergenic
931434077 2:62232084-62232106 CACAACATGAAGACTGCAGTGGG + Intergenic
932790481 2:74650474-74650496 CACCACATTCAGTCAGTGGCTGG - Intergenic
934216576 2:90036910-90036932 CAAAACATGCAGACTGGGGGTGG + Intergenic
936050288 2:109217578-109217600 TAACACATGCAGGATGTGGTAGG - Intronic
937978672 2:127597533-127597555 TACAACATGCAGCCTGGGGTGGG + Intronic
938500342 2:131828931-131828953 CACCACTTGCAGGGTGCGGTAGG + Intergenic
942323620 2:174756980-174757002 CACAACATGCAGTCTGTCGTGGG + Intronic
946119333 2:217495767-217495789 CACCACATTGAGAATGTAGTGGG - Intronic
947003893 2:225488697-225488719 CACCACATCCAGCCTTTGATAGG + Intronic
1168994871 20:2125636-2125658 CAGCACAGGCACACTGTGGCAGG + Intronic
1171201170 20:23243584-23243606 CTCCACATGGGGACTGTGGTGGG + Intergenic
1171363974 20:24611157-24611179 CACAACCTGGAGAATGTGGTGGG - Intronic
1174411248 20:50338029-50338051 CTCCACCTGGAGCCTGTGGTTGG + Intergenic
1175869881 20:62203859-62203881 CCACACATGCTGACTGTGGGGGG - Intergenic
1178514834 21:33237553-33237575 CACCACATCCAGATTGTAGAAGG - Intronic
1181475245 22:23164075-23164097 CACTAAATGCAGCCTGTGGTCGG + Exonic
1181522322 22:23456796-23456818 CACCAACTGCAGGATGTGGTGGG - Intergenic
1183938400 22:41277968-41277990 CACCACATTCAGCCTGTGCTGGG + Intronic
1184887260 22:47354019-47354041 CACCCCAGGCAGATAGTGGTGGG + Intergenic
1184944857 22:47795877-47795899 CACCACATGGACACTGAGGGTGG + Intergenic
949959809 3:9302563-9302585 CACCACCTGGAGCCTGTGGGTGG + Intronic
954673100 3:52301112-52301134 CACCACATGCTCGCTTTGGTGGG - Intergenic
955591579 3:60541470-60541492 CCCCACATGTAGAATATGGTGGG - Intronic
957672487 3:83323827-83323849 CACCACATCTGGACTGTGATGGG + Intergenic
962720223 3:138166865-138166887 CACCTAAGCCAGACTGTGGTGGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
966730589 3:183147824-183147846 TACCACATGCAAGCTGAGGTGGG - Intronic
968936280 4:3612137-3612159 CCCCACATGCAGAGTGGGCTTGG - Intergenic
969327629 4:6452958-6452980 CACTGCAGGCAGCCTGTGGTTGG + Intronic
970479676 4:16460346-16460368 CTCCACAGGCAGGCTGGGGTAGG - Intergenic
974898384 4:67967573-67967595 CACACTCTGCAGACTGTGGTGGG - Intergenic
976643136 4:87360540-87360562 CACCAAATGCATACAGTGATTGG + Intronic
976839129 4:89410789-89410811 CAACACTAGCAGACTGTGGGTGG - Intergenic
977039428 4:91996995-91997017 GACCACATGATGACTGTTGTGGG + Intergenic
977280973 4:95039687-95039709 CACCACATGCAGCCCATGCTTGG + Intronic
984664004 4:182405878-182405900 CACCACAAGCAGGCTTGGGTCGG + Intronic
985836130 5:2273184-2273206 CACCGCATGCAGAGGGTGGAGGG - Intergenic
986317348 5:6599048-6599070 CACCAAAGGCAGTGTGTGGTCGG + Intergenic
986405321 5:7419634-7419656 AACCACATTCAGACTGTCCTGGG + Intronic
987020400 5:13864463-13864485 CCCCACATCCAGACTGTGCCCGG + Exonic
988599258 5:32624284-32624306 CAGAACAAGTAGACTGTGGTAGG + Intergenic
993461887 5:88192206-88192228 AACCACATGCAGGGAGTGGTGGG + Intronic
995775644 5:115722439-115722461 CACCACATGCAGTCTGATGAAGG - Intergenic
997800504 5:136856199-136856221 CACCACATGAAGAATGGGGAGGG + Intergenic
999690629 5:154143085-154143107 CACCACATGCCAGGTGTGGTAGG - Intronic
1000130210 5:158289948-158289970 CAGCACATGCAGGTAGTGGTGGG + Intergenic
1000442811 5:161283363-161283385 CAGCACATGCAGAGCTTGGTGGG - Intergenic
1001890316 5:175333008-175333030 CACAAGAAGGAGACTGTGGTGGG - Intergenic
1010355646 6:74929486-74929508 CACCAGATGCACTCTGTGGGTGG + Intergenic
1017595691 6:156026420-156026442 TACCAAATGCTGACTGTGATAGG + Intergenic
1021683485 7:23158253-23158275 CACCACAGCCAGCCTGGGGTGGG + Intronic
1026072081 7:67130812-67130834 TGCCAAATGCAGACTGTGGGAGG - Intronic
1026975626 7:74495970-74495992 CACTGCATTCAGACTGTGCTGGG + Intronic
1027426702 7:78068473-78068495 TAACAAATGCACACTGTGGTGGG + Intronic
1029584484 7:101461727-101461749 CATCACATCCACACTGTGGCTGG + Intronic
1031026521 7:116685765-116685787 ACCGACATGCAGACTCTGGTTGG - Intronic
1031726455 7:125245894-125245916 CAACACTTGCTGACTGAGGTAGG + Intergenic
1032403429 7:131639316-131639338 CACGAAATGCAGACAGGGGTGGG - Intergenic
1032668738 7:134064400-134064422 CACCGCAGCCAGACTGGGGTGGG + Exonic
1034426381 7:151016361-151016383 AACAACATGGAGACTGAGGTGGG - Intronic
1037831862 8:22194516-22194538 CGCCAGATGCAGACTTTGCTGGG - Exonic
1038883929 8:31641829-31641851 CATCACAGGCAGACTCTGCTTGG - Intronic
1040107444 8:43548735-43548757 CCCCCCATGCAGCCTGAGGTGGG + Intergenic
1041047029 8:53897264-53897286 CAGCACAAGCAGACTGGGCTAGG + Intronic
1048363942 8:133721917-133721939 CACTACACTCAGACTGTGGAAGG + Intergenic
1049548104 8:143244005-143244027 CACCAAATGGAGTCTCTGGTGGG + Intergenic
1050526946 9:6554572-6554594 CAACACATGAAGACTTTGATGGG + Intronic
1055435567 9:76288713-76288735 AACCCCATGCAGACTGTGAAAGG - Intronic
1057432810 9:95010350-95010372 CAACAGATGGTGACTGTGGTAGG + Intronic
1059226990 9:112681490-112681512 TACCACATGCTGACTGGTGTGGG + Intergenic
1060268323 9:122125142-122125164 CATTACATGCAGATTGGGGTAGG + Intergenic
1060542392 9:124439763-124439785 CACCACATGCTGGCTGCCGTAGG - Intergenic
1061627199 9:131847735-131847757 TACCACATACACACTGTGGCAGG - Intergenic
1061773710 9:132946497-132946519 GACCCCATGCAGACTATGCTTGG - Intronic
1062546495 9:137065964-137065986 CACCACAGGCAGACTTCGGGAGG - Intronic
1186512356 X:10139281-10139303 CACCACTCGCTGACTGTGGTTGG + Intronic
1188101921 X:26098748-26098770 CAACACATTCATACTGAGGTTGG + Intergenic
1189077910 X:37937398-37937420 GACCACATGAAAACTGTGGATGG + Intronic
1189333702 X:40157562-40157584 AACAACATGCAAACTTTGGTTGG + Intronic
1190948437 X:55118764-55118786 CACCACATCCTCACTGTGGTAGG - Intronic
1191669443 X:63735428-63735450 CACCACAGGCAGAGGGTGGGTGG + Intronic
1192244671 X:69362548-69362570 CACCACATGCTGCCTGGGTTTGG + Intergenic
1195285081 X:103376357-103376379 CACCTCATGCAGACGGGAGTAGG + Intronic
1199423318 X:147672645-147672667 CACCGCATGCAGCCTTTGATAGG - Intergenic
1200788194 Y:7276847-7276869 CACCACGTCCAGCCTGTGATTGG - Intergenic