ID: 925360679

View in Genome Browser
Species Human (GRCh38)
Location 2:3278305-3278327
Sequence CTGCCCACATGCCCTGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 569
Summary {0: 1, 1: 2, 2: 11, 3: 63, 4: 492}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925360677_925360679 3 Left 925360677 2:3278279-3278301 CCACATGCAGACTGTGGTTGGTG 0: 1
1: 0
2: 4
3: 7
4: 149
Right 925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG 0: 1
1: 2
2: 11
3: 63
4: 492
925360670_925360679 27 Left 925360670 2:3278255-3278277 CCCCATCAGCTGCTGCCATCCAC 0: 1
1: 0
2: 2
3: 31
4: 309
Right 925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG 0: 1
1: 2
2: 11
3: 63
4: 492
925360675_925360679 8 Left 925360675 2:3278274-3278296 CCACACCACATGCAGACTGTGGT 0: 1
1: 0
2: 0
3: 16
4: 237
Right 925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG 0: 1
1: 2
2: 11
3: 63
4: 492
925360673_925360679 12 Left 925360673 2:3278270-3278292 CCATCCACACCACATGCAGACTG 0: 1
1: 1
2: 1
3: 18
4: 231
Right 925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG 0: 1
1: 2
2: 11
3: 63
4: 492
925360672_925360679 25 Left 925360672 2:3278257-3278279 CCATCAGCTGCTGCCATCCACAC 0: 1
1: 1
2: 3
3: 45
4: 338
Right 925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG 0: 1
1: 2
2: 11
3: 63
4: 492
925360671_925360679 26 Left 925360671 2:3278256-3278278 CCCATCAGCTGCTGCCATCCACA 0: 1
1: 0
2: 0
3: 30
4: 261
Right 925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG 0: 1
1: 2
2: 11
3: 63
4: 492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925360679 Original CRISPR CTGCCCACATGCCCTGCCCT TGG Intronic
900165461 1:1242708-1242730 CTGCCCACCTGCCCTGCGCTAGG + Intronic
900309256 1:2025437-2025459 GTGCCCACAGCCTCTGCCCTGGG + Intronic
900417558 1:2542093-2542115 CTGCCCACCTGCCCTAGCCCAGG - Intergenic
900516803 1:3085978-3086000 CTGACCCCATGCCCTGGTCTGGG + Intronic
900687117 1:3955643-3955665 TTTCCCACAGGCCATGCCCTGGG + Intergenic
901630332 1:10644891-10644913 CTGCCCGCAGCCCCAGCCCTCGG + Intronic
901639825 1:10687558-10687580 CTGGCCTCACTCCCTGCCCTGGG + Intronic
901653372 1:10755632-10755654 CTCCCCACACCCCCTGCCTTCGG - Intronic
902209204 1:14892663-14892685 CTGCCCACCACCCCTGCCCATGG + Intronic
902239761 1:15080737-15080759 CTGTCAACACTCCCTGCCCTTGG - Intronic
902379398 1:16045536-16045558 GTGACCCCATGCCCTGCCCCAGG + Exonic
902691390 1:18111881-18111903 CTACTCACATGCCCTGCCCAAGG - Intronic
903336303 1:22626896-22626918 CAGCCCACAAGCCCTGCCCTAGG - Intergenic
904599760 1:31666901-31666923 TTGCCCTCTTGCCCTGCCGTGGG - Intronic
904624219 1:31793132-31793154 TTGCCCCCATGCCCTGCACAGGG + Intronic
904880987 1:33696725-33696747 CTGCCCACCTGCCAGGCCCCAGG - Intronic
905259548 1:36707815-36707837 TTCCCCACACTCCCTGCCCTAGG - Intergenic
905395493 1:37663886-37663908 CTCCCCACATGCCCAGCTCCGGG + Intergenic
905625896 1:39490796-39490818 CTGCACACCTGCTCTTCCCTGGG - Intergenic
906614508 1:47225398-47225420 CTGCCCACCCGCCCAGCCCCTGG + Intronic
906674136 1:47681116-47681138 CAGGCCCCCTGCCCTGCCCTGGG + Intergenic
906797281 1:48708279-48708301 TTGCTCACATCACCTGCCCTGGG - Intronic
907491989 1:54814363-54814385 CTGCCCACTTGCTCCGCCCAAGG + Intronic
912800176 1:112715303-112715325 CTGCCTCCCTGCCCCGCCCTCGG + Exonic
914858577 1:151369379-151369401 CTGCCCTCATCCCTGGCCCTGGG - Intronic
914921959 1:151853337-151853359 CTGCCCACCTGCCCTGGCCATGG + Intronic
915276154 1:154789645-154789667 CTTCACACCTGCCCTGCCATCGG + Intronic
915281104 1:154822707-154822729 CTGCCTCCCTCCCCTGCCCTTGG - Intronic
918742236 1:188147150-188147172 CTGCCCTCATTCCTTGCTCTTGG + Intergenic
919283422 1:195520932-195520954 CTGACCACATGCTCTGCCATAGG + Intergenic
920089479 1:203441980-203442002 CTGCTCACTTTCCCTGCCCTCGG - Intergenic
920111979 1:203593274-203593296 CTGCTCACCTGCCCACCCCTAGG + Intergenic
920297479 1:204967869-204967891 CTGCTGAGATGGCCTGCCCTGGG + Intronic
920678228 1:208053404-208053426 ATGCCCACTGCCCCTGCCCTGGG + Intronic
921148515 1:212381655-212381677 CTGTGCACATGCCCAGGCCTGGG - Intronic
921153568 1:212420562-212420584 CTGTCCACATGCACTTCCCTTGG + Intergenic
921257321 1:213354397-213354419 CTGCTCACCTGCCCTGACCTGGG + Intergenic
922551277 1:226496446-226496468 CTGCACATTTGCCGTGCCCTTGG + Intergenic
923238101 1:232054688-232054710 CTGCCACCCTGCCCTGGCCTCGG + Intergenic
923264458 1:232300839-232300861 CTGCCCTCAGGCCCTTTCCTTGG - Intergenic
923396405 1:233569205-233569227 GAGTCCCCATGCCCTGCCCTGGG + Intergenic
923809181 1:237293709-237293731 CTTCCCACATTTCCTGCCCTAGG - Intronic
924894020 1:248316650-248316672 CTGCAGAGATGGCCTGCCCTGGG + Intergenic
1063434300 10:6018152-6018174 CTGCCCCCATGCCAAGCCCAGGG - Intronic
1063455955 10:6182819-6182841 CTGCCCTCCTGCCCTGGCCATGG - Intronic
1063474293 10:6315087-6315109 CAGCCCACCTGCCCACCCCTAGG + Intergenic
1063625559 10:7686385-7686407 GTGCCCACATGGCCCGGCCTGGG + Intergenic
1064433377 10:15290290-15290312 CTGACCCCATCCCCTGCCCTCGG + Intronic
1065133288 10:22643898-22643920 CTGGCCACTTCCCCTTCCCTTGG + Intronic
1067137509 10:43624448-43624470 CTTCCCACATGCCTCACCCTAGG - Intergenic
1067150283 10:43726870-43726892 CTGAACACATGCACGGCCCTGGG - Intergenic
1067472730 10:46548291-46548313 TTGCCCACATGACCTGACCTAGG - Intergenic
1067575571 10:47406390-47406412 CTGCCCGCAGGCTCTGCCCATGG + Intergenic
1069710996 10:70488696-70488718 CTGAGCACATGCCCTGAGCTGGG + Intronic
1069789811 10:71012322-71012344 TTGCCCACCTGTCCTGCCCATGG - Intergenic
1070587793 10:77779830-77779852 CTGCCCCCTTCCCCGGCCCTGGG - Intergenic
1071481632 10:86069240-86069262 CTGCTCACATCACCTCCCCTTGG - Intronic
1071601707 10:86961740-86961762 GTGGCCACCTGCCCTGCCCCTGG + Intronic
1072965220 10:99966321-99966343 CTGCCCACATCCTCTTCCTTTGG + Intronic
1073915355 10:108396940-108396962 CTTCTCTCATGCCTTGCCCTAGG - Intergenic
1074447283 10:113530846-113530868 CTCCCCATCTGCACTGCCCTCGG + Intergenic
1075091067 10:119444442-119444464 CGGCCCTCAGGCCCTTCCCTGGG + Intronic
1075303918 10:121350635-121350657 CTGTGTACATGCCCTTCCCTTGG + Intergenic
1075463303 10:122632727-122632749 CTGGACACAGGCCTTGCCCTTGG - Intronic
1075669524 10:124254791-124254813 CTGCTCAGATCCCCAGCCCTAGG + Intergenic
1075899034 10:126023501-126023523 CTGCCCATATGTCTTGACCTTGG - Intronic
1075906113 10:126083392-126083414 CTGCCCAGAGGCCCTGCCCTGGG - Intronic
1075908891 10:126106426-126106448 TTCCCCACTTCCCCTGCCCTGGG + Intronic
1075998359 10:126895900-126895922 AAGCCCAAGTGCCCTGCCCTGGG - Intergenic
1076156896 10:128211284-128211306 CTGGCAGCATCCCCTGCCCTGGG - Intergenic
1076368222 10:129935805-129935827 CAGCCCACATTCTATGCCCTTGG - Intronic
1077158836 11:1103513-1103535 GTGCCCCCATGTCCTGCCCCAGG + Intergenic
1077262580 11:1630601-1630623 CTGCCCAGCTTCCTTGCCCTGGG + Exonic
1077300478 11:1844300-1844322 CTGCCCACAACCCCTGCCCTGGG - Intergenic
1077391052 11:2300824-2300846 CTGCCCACTTGCACAGCCCGGGG + Intronic
1077399025 11:2343970-2343992 CTGCGCACCTGCCTTGCCCAAGG - Intergenic
1077405954 11:2382622-2382644 CTGCCCACCTGCCCTGATCCTGG - Intronic
1077468997 11:2748099-2748121 CTGGCCACAAGCCCAGCCCTGGG - Intronic
1077506499 11:2932099-2932121 CTGCCCACAGTCCCTGCCCCAGG + Intergenic
1077581914 11:3422567-3422589 CTGCCCCCGCGCACTGCCCTGGG - Intergenic
1077596308 11:3534642-3534664 GTGCCCACATACACTGCCCATGG + Intergenic
1078068970 11:8096005-8096027 CCCACCACAAGCCCTGCCCTAGG + Intronic
1078412929 11:11142495-11142517 TCGCCCACATTCCCTGGCCTGGG + Intergenic
1079101181 11:17543378-17543400 CTCCCCACAGGCCCTGCCTGAGG - Intronic
1079645492 11:22860117-22860139 CTGCCCCATTGGCCTGCCCTAGG - Intronic
1080135264 11:28846564-28846586 TTGACCACATGCCATGCACTGGG + Intergenic
1080873505 11:36257369-36257391 CTGCCCCCACCCCCTGCCCCAGG - Intergenic
1080938417 11:36886411-36886433 CTGCCCACATTCCCAGTCTTTGG + Intergenic
1081621287 11:44620406-44620428 CTGCTCACACCCTCTGCCCTGGG - Intergenic
1082794819 11:57371249-57371271 CTGCCCCAGAGCCCTGCCCTGGG - Intergenic
1083148312 11:60774553-60774575 CTGCCCCCATGCCCTGAGCCTGG - Intronic
1083306920 11:61766149-61766171 CTGCCCCCAAGCCCTTCCCGGGG + Exonic
1083541069 11:63511760-63511782 CTGCTCACATGCTCTTCCCCAGG + Exonic
1083630170 11:64091187-64091209 CTGCCCACTTCCCTTGCCCCAGG - Intronic
1083651774 11:64208365-64208387 TTACCCTCATGCCGTGCCCTGGG - Intronic
1083996728 11:66276659-66276681 CTGGCCACATTCCTCGCCCTGGG - Exonic
1084164161 11:67367249-67367271 CTGCCCACATGCCTAGTCCTGGG + Intronic
1084252216 11:67908619-67908641 GTGCCCACATACACTGCCCATGG + Intergenic
1084332047 11:68436258-68436280 TTCCCCACCTGCCCTGCCCCCGG - Intronic
1084820633 11:71687414-71687436 GTGCCCACATACACTGCCCATGG - Intergenic
1084833597 11:71787444-71787466 CTGCCCCGGTGCACTGCCCTGGG + Intergenic
1086833252 11:91592487-91592509 ATGTCAACATACCCTGCCCTAGG - Intergenic
1088685599 11:112282031-112282053 CTGCCCTCATCCCCTGCCACAGG - Intergenic
1088869020 11:113875635-113875657 TGGCCCACATGCCCCGCCCCCGG + Intergenic
1089316235 11:117593157-117593179 GGGCCCACGTGTCCTGCCCTCGG + Intronic
1089453014 11:118610140-118610162 CTCCCCGCATCCTCTGCCCTCGG + Intronic
1089453595 11:118612904-118612926 ATGCCCCCATGCCCATCCCTTGG - Intronic
1089641833 11:119852964-119852986 CTGTCCTCCTTCCCTGCCCTGGG + Intergenic
1090048439 11:123357097-123357119 CCTCCCAAATGCCCTTCCCTCGG - Intergenic
1090237308 11:125158780-125158802 CTGCCCACAACCCCTGCCCAGGG - Intergenic
1090429803 11:126636215-126636237 CTTAGCACATGCCATGCCCTGGG - Intronic
1090489362 11:127144622-127144644 CTTGCCACCTGCCCTTCCCTCGG + Intergenic
1090876277 11:130791568-130791590 CCGCACACATGCCCTGACCTTGG - Intergenic
1092422483 12:8343413-8343435 GTGCCCACATACACTGCCCATGG + Intergenic
1092892540 12:12982157-12982179 CTAGCCAAAGGCCCTGCCCTTGG + Intronic
1093189415 12:16057559-16057581 CAGCCCACCGGCGCTGCCCTCGG + Intergenic
1095905084 12:47369238-47369260 CTGCCCACGTGCTCTTTCCTAGG - Intergenic
1096322256 12:50625445-50625467 ATTCCCACATCCCCTCCCCTTGG - Intronic
1096402946 12:51322682-51322704 CTTCCCATAGGCCCTGCTCTCGG + Intronic
1097248156 12:57618016-57618038 ATGTCCAGATGCCCTGTCCTGGG + Intronic
1097367764 12:58738646-58738668 TTTCCCACTTGCCCTGCCCCTGG - Intronic
1097967168 12:65593768-65593790 CTGCACACATGCACTGCACTGGG - Intergenic
1098035962 12:66302405-66302427 CCTTCCACATGCCCTCCCCTCGG + Intergenic
1098250475 12:68564120-68564142 CTGCCCACAGAACCTGCTCTAGG + Intergenic
1098909043 12:76190646-76190668 GTGCCCACATGACCAGCCCCTGG - Intergenic
1101842028 12:108334587-108334609 CTTCCCTCATGCCCAGCCCTGGG + Intronic
1101993202 12:109504540-109504562 CTCCTCACAGGCCCTGCCCCCGG - Intronic
1102199164 12:111045530-111045552 CTCACAACATGCCCAGCCCTAGG - Intronic
1103274475 12:119700205-119700227 CAGCCCACAGTCCCAGCCCTGGG - Intronic
1103648174 12:122411752-122411774 CTGCCAACTTTCCCAGCCCTAGG - Intronic
1103797307 12:123513317-123513339 GTCCCGACATGCCCTGTCCTGGG + Intronic
1103984016 12:124755230-124755252 CTCCCCATCTGCCCTTCCCTGGG + Intergenic
1104048591 12:125181518-125181540 GTGGCAACATGCCCAGCCCTGGG - Intergenic
1104192424 12:126495140-126495162 ATTCCCCCATCCCCTGCCCTTGG + Intergenic
1104428325 12:128696129-128696151 CTGCACACATGCCCAGTGCTGGG - Intronic
1104623860 12:130337690-130337712 CGCCCCACAGGCCCTGCCCCTGG - Intergenic
1104811531 12:131622699-131622721 CGGCCCTCCTGCCCTGCCCCGGG - Intergenic
1105307107 13:19176799-19176821 ATGCCCACATGCCTAGCCCATGG + Intronic
1105789917 13:23788468-23788490 TTGTCCACATCTCCTGCCCTTGG - Intronic
1106885380 13:34179135-34179157 CTTCCCATATGCCCTGCACCAGG + Intergenic
1107470846 13:40689783-40689805 CTGCCCACAGCCCCTGCTCTGGG + Intergenic
1108228185 13:48311932-48311954 CTGACCTCATGATCTGCCCTCGG + Intronic
1110789191 13:79568652-79568674 CAGGCTACATGCCCTGCCCTTGG - Intergenic
1112203699 13:97303155-97303177 CTGCCCACATGTCCTTCACTGGG - Intronic
1114669272 14:24400143-24400165 CTTCCCAGATTCCCAGCCCTTGG + Intronic
1115664868 14:35534943-35534965 GTGACCACATCCCCTGTCCTGGG + Exonic
1117302991 14:54446626-54446648 GCCCCCACCTGCCCTGCCCTTGG - Intergenic
1118453909 14:65928483-65928505 CGGCCCCCACCCCCTGCCCTGGG + Intergenic
1119201074 14:72753359-72753381 CTGTCCACAGGCCTTGCCCCGGG - Exonic
1119947285 14:78708249-78708271 CTGCCTCCATGCCCTACCCAAGG - Intronic
1120902331 14:89586657-89586679 CTGCCCGCATCCCCTGCACTGGG - Intronic
1121290042 14:92766665-92766687 CTGCCCAGGTCCCCTGTCCTGGG - Intergenic
1121465336 14:94111960-94111982 CTGGCCAGATGCCCAGCCCTGGG + Intronic
1121876518 14:97458107-97458129 CTGGACACATGCTCTGACCTTGG - Intergenic
1122077997 14:99247882-99247904 TTCCCCCCATCCCCTGCCCTGGG - Intronic
1122083911 14:99286237-99286259 CTGGACACAGACCCTGCCCTCGG + Intergenic
1122148117 14:99706239-99706261 CTCCTTACCTGCCCTGCCCTGGG - Intronic
1122163321 14:99802388-99802410 CTTCCCACCTGCCCTCCCCCTGG - Intronic
1122694599 14:103546594-103546616 TTGCCCACAGGCCCTGCCACGGG + Intergenic
1122971215 14:105152973-105152995 CTGGCCACCTGCCCTCTCCTGGG - Intronic
1124011995 15:25846140-25846162 CTTCCCCCATGCCCAGCCCCTGG - Intronic
1124247481 15:28083433-28083455 CTGCCGACATGGCCTGCCTTCGG - Intronic
1125479167 15:40069042-40069064 CTCACAGCATGCCCTGCCCTTGG + Intergenic
1127350041 15:58142100-58142122 GAGCCCAGTTGCCCTGCCCTGGG + Intronic
1128536741 15:68497280-68497302 TTCCCCACATCCCCTTCCCTAGG - Intergenic
1128766338 15:70253261-70253283 CTGCCCCCATGCCCTCGCTTTGG - Intergenic
1129048837 15:72761022-72761044 GTTCCCACATGTCCTGTCCTTGG - Intronic
1129880209 15:79001466-79001488 GTGCCCACAGCCCCTTCCCTTGG + Intronic
1130690375 15:86077185-86077207 CCTCCCCCATGGCCTGCCCTAGG + Intergenic
1130893536 15:88152845-88152867 CTGCCCACTTGCCCACCCCCTGG + Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132314260 15:100879287-100879309 CTGCGCACGTGCCCTGCTCTTGG - Intronic
1132605731 16:792971-792993 CGGCCCTCATGCCCTGCCGCAGG - Exonic
1132742346 16:1421098-1421120 CTGCCCGCCTGCCCTGGGCTGGG + Intergenic
1132854455 16:2038631-2038653 CTGCCCACCTGCCCTGGTGTGGG + Exonic
1133219148 16:4311473-4311495 CTGACAACATGCCAGGCCCTGGG + Intergenic
1133375798 16:5286188-5286210 GTGCCCACATACACTGCCCATGG - Intergenic
1134665395 16:16014882-16014904 CGGCCCACAGCTCCTGCCCTTGG - Intronic
1136228531 16:28874004-28874026 GAGCCCAAATCCCCTGCCCTGGG - Exonic
1136315123 16:29449830-29449852 CATCCCACATCCCCTGCCATGGG - Intronic
1136429700 16:30189169-30189191 CATCCCACATCCCCTGCCATGGG - Intergenic
1136449121 16:30342792-30342814 CCGCCCACCTGCCCTCCCCAAGG + Intergenic
1136748633 16:32614035-32614057 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1137346461 16:47666461-47666483 CTCCCCAGATCCCCTGCCCCAGG + Intronic
1138093903 16:54197178-54197200 CTGCCCTCCTGTCCTGCCCAGGG - Intergenic
1138297596 16:55900191-55900213 CTGCTGTCATGCCCTGCCCCAGG + Intronic
1138581630 16:57945379-57945401 CTGCCCACAGGCCCAGCCAGAGG + Intronic
1139421983 16:66854692-66854714 CTGCACACTTGCCCTTCCCTTGG - Intronic
1139475479 16:67200564-67200586 CTGCCCCCACCCGCTGCCCTAGG - Intronic
1139701978 16:68713484-68713506 GTGCCCACCTCCCCTGACCTAGG + Intronic
1140144526 16:72293614-72293636 CTGACAACATGCCTTGCCTTTGG + Intergenic
1140519962 16:75572428-75572450 CAGCCTCCATGACCTGCCCTTGG + Intronic
1140892334 16:79295817-79295839 CTGCCAACAGCCCCTGCCTTAGG - Intergenic
1141148300 16:81547287-81547309 CTGCACACACCCCATGCCCTCGG - Intronic
1141615040 16:85205659-85205681 CTGCCCATCTCCCCTGCCCTGGG + Intergenic
1141633502 16:85301723-85301745 GTGCCCCTCTGCCCTGCCCTGGG - Intergenic
1141666830 16:85470039-85470061 CTGCCCAGAGGCCCCTCCCTGGG + Intergenic
1141860375 16:86712318-86712340 CAGCTCACCTGCCCTGCCCCTGG + Intergenic
1142061840 16:88035491-88035513 TTGCCCACGTTCCCTGTCCTGGG - Intronic
1203050766 16_KI270728v1_random:873249-873271 CTGCCCAGAGGCTCTGCCCTGGG - Intergenic
1142524630 17:531290-531312 CTGCCCACCTGAACTGGCCTGGG + Intronic
1144584990 17:16482451-16482473 CTGCCCACTTGGCCTTCCCACGG - Intronic
1144684792 17:17218936-17218958 CTGCCCACACGCCTTGCCTCTGG - Intronic
1144851674 17:18247097-18247119 CTGCGCATAGGCCCCGCCCTCGG + Intronic
1144888710 17:18481261-18481283 CTGCCCCCATGACCTGTACTTGG + Intronic
1145055361 17:19700093-19700115 CTGCTCCCATCTCCTGCCCTGGG - Intronic
1145143497 17:20463037-20463059 CTGCCCCCATGACCTGTACTTGG - Intronic
1146640705 17:34538893-34538915 ATGCCCAAATGCCCTGCATTTGG - Intergenic
1146698806 17:34935232-34935254 CTACCCACCTCCCCAGCCCTGGG - Intronic
1146720850 17:35122428-35122450 CTGCCCACACGCTCTTCTCTGGG - Intronic
1146934621 17:36805076-36805098 CTGCCCCCAAGCCTGGCCCTGGG + Intergenic
1147170107 17:38613411-38613433 CTCCCCACATGCCAGGCCCTGGG + Intergenic
1147932151 17:43988491-43988513 CTGACCACTTCACCTGCCCTGGG + Intronic
1148480369 17:47956082-47956104 CAGCCCTTGTGCCCTGCCCTGGG + Intronic
1148701872 17:49592464-49592486 CTAGCCACCTGGCCTGCCCTAGG + Intergenic
1149638215 17:58186796-58186818 CTTCCCACATGCCCAGCCCTGGG + Intergenic
1150144352 17:62755292-62755314 CTTCCCACATGTCTGGCCCTAGG + Intronic
1150287626 17:63962854-63962876 GTGCCCATATGCCCTGCCAGAGG - Intronic
1150316831 17:64175915-64175937 CTACCCATATGCCTTGACCTGGG + Intronic
1150481747 17:65516539-65516561 CCGCCCCCATCCCCAGCCCTAGG - Intergenic
1151191333 17:72400188-72400210 CTGATCACCGGCCCTGCCCTTGG - Intergenic
1151396748 17:73827762-73827784 CTGCAGTCAGGCCCTGCCCTGGG + Intergenic
1151479827 17:74363395-74363417 CTGCCCGCCTGCCCTTCCCATGG + Intergenic
1151930317 17:77228024-77228046 CTGCCCACATTCTCTGCCCTGGG + Intergenic
1152234714 17:79132700-79132722 CTGCTCACTGGCCCTCCCCTGGG + Intronic
1152589246 17:81203314-81203336 CTGACCACGTGCCCTGACCGAGG + Intronic
1152589255 17:81203353-81203375 CTGACCGCATGCCCTGACCAAGG + Intronic
1152595754 17:81236850-81236872 GTGCCCCCGGGCCCTGCCCTGGG - Intronic
1152624069 17:81380192-81380214 CTCCCCACCCGCCCTGCCCCAGG + Intergenic
1152738493 17:82008875-82008897 CTGCCCCCAGGACCTGGCCTTGG + Intronic
1153781856 18:8501801-8501823 CTGCCCCCACCCCCTACCCTAGG + Intergenic
1154975190 18:21450673-21450695 CTGCCCAATTGGCCAGCCCTGGG + Intronic
1155274607 18:24174126-24174148 CAGCCCACATGCCCTTCAGTGGG - Intronic
1155554317 18:27001340-27001362 CTGCTCACATTCCATGCCCAAGG + Intronic
1155830749 18:30512979-30513001 CTGCACACCTGGCTTGCCCTTGG - Intergenic
1157518750 18:48330225-48330247 GTGCCCAGGTGCCCTGCTCTGGG - Intronic
1157609891 18:48949729-48949751 CTGCACAAACGCACTGCCCTAGG + Intronic
1157676340 18:49571510-49571532 ATGCCCACATGCCCTGAGCATGG + Intronic
1159968622 18:74621627-74621649 CTTCCTGCATGCCCTCCCCTAGG - Intronic
1160447115 18:78936619-78936641 CTGCCCACCTCCCCGGCTCTCGG - Intergenic
1160451907 18:78972077-78972099 TTGCCCACATGCCTGGACCTTGG - Intergenic
1160572421 18:79827259-79827281 CCACCCACATCTCCTGCCCTGGG - Intergenic
1160717140 19:581609-581631 CTGCCCACATGCCCTGCTCTCGG + Intronic
1160902036 19:1433549-1433571 CTGCCCCCACGCCCAGGCCTTGG + Intronic
1161568015 19:5014017-5014039 CTTCCCACAGGCCCCGCCCCGGG - Intronic
1161571430 19:5032810-5032832 GTGCCGCCATGCCCAGCCCTTGG - Intronic
1161806955 19:6449931-6449953 CAACCCCCATGCCCCGCCCTGGG + Intronic
1162933461 19:13968733-13968755 TTCCCCGCCTGCCCTGCCCTGGG + Intronic
1162997126 19:14343271-14343293 CTACCCATAGGCCCTGCTCTTGG + Intergenic
1163320372 19:16571485-16571507 CTGCCCAGAGTCCCTGCCCGGGG + Intronic
1163687477 19:18719899-18719921 CTGCCCACATGGACGGGCCTGGG - Intronic
1163689766 19:18732095-18732117 AGGCCAACATGCCCTGCCCCTGG - Intronic
1163748488 19:19061731-19061753 GTGCCCACCTGCCAGGCCCTGGG - Intergenic
1164443937 19:28301035-28301057 CTGACCCCACGCCCAGCCCTAGG + Intergenic
1164574519 19:29397923-29397945 TGGGCCACATGCCGTGCCCTGGG - Intergenic
1164721052 19:30431781-30431803 CAGCGCACAGCCCCTGCCCTGGG - Intronic
1164734579 19:30531592-30531614 CTCCCTACCTCCCCTGCCCTTGG + Intronic
1165050721 19:33139853-33139875 CTGCCCAGTTGTCATGCCCTTGG - Intronic
1165068717 19:33243054-33243076 CTGCCCTAATGCCTTTCCCTGGG - Intergenic
1165092863 19:33395854-33395876 CAGCCCTCAGGGCCTGCCCTGGG - Intronic
1165256237 19:34578551-34578573 CAGACCACAGGCCCAGCCCTGGG - Intergenic
1165776403 19:38406912-38406934 CTGCCCTCATGGCCTCTCCTTGG - Exonic
1166875673 19:45895804-45895826 CTTCCCACATGTCGTTCCCTGGG + Intronic
1167117833 19:47498321-47498343 CTCCCCACAGCCTCTGCCCTTGG - Intronic
1167423986 19:49420326-49420348 CCACCCACATGCCCTGCCTCAGG - Intergenic
1167433501 19:49465995-49466017 CTGTCCACAGCCCCTACCCTGGG - Intronic
1167507655 19:49879379-49879401 CTGACCACCTGCGCTGCCCCAGG + Intronic
1167518641 19:49938804-49938826 CAGCCCAGATGGCCTTCCCTCGG + Intronic
1168281798 19:55309881-55309903 CTGTCCACGTGCCCTGCAATGGG - Intronic
925064452 2:918839-918861 CTTCCCAGATGCTCTGCCGTGGG - Intergenic
925132491 2:1503616-1503638 CTGCCCCCGTGTCCTGCACTTGG + Intronic
925302934 2:2829815-2829837 GTGGCCACATGGCCTTCCCTGGG - Intergenic
925360679 2:3278305-3278327 CTGCCCACATGCCCTGCCCTTGG + Intronic
927080597 2:19626086-19626108 CTGCCTACATGCACCTCCCTGGG + Intergenic
927146103 2:20167714-20167736 CTGCCCACATCCCCTTTTCTGGG - Intergenic
929533612 2:42767257-42767279 CAGCCCAGATGCCATGCCCCTGG - Exonic
930700806 2:54456635-54456657 CTGCCCGCCTGCCCTGCGCCCGG + Intronic
931368392 2:61639475-61639497 GGGCCCACATGCCCTAACCTAGG - Intergenic
931779318 2:65565864-65565886 CTGTCCACAGGCACTGCACTTGG + Intergenic
932219111 2:69986594-69986616 CAGACCACAGGCGCTGCCCTGGG + Intergenic
932343701 2:70982320-70982342 CTGCCCTCCTTTCCTGCCCTGGG + Intronic
932431670 2:71679256-71679278 CTTCCCCCATGCCCTCCACTGGG - Intronic
932728697 2:74201622-74201644 GTGCCACCATGCCCAGCCCTGGG + Intronic
934564190 2:95329456-95329478 TTGCTCACATGCCCTGACATGGG + Intronic
934734621 2:96683611-96683633 CTGCCCACCTGGTCAGCCCTAGG + Intergenic
935050612 2:99522086-99522108 CTGACCCCAACCCCTGCCCTAGG + Intergenic
935332389 2:101986507-101986529 CTGCCCTGATTGCCTGCCCTGGG + Intergenic
937527771 2:122791817-122791839 CTGCAAACATGCCCTTCACTTGG - Intergenic
938065217 2:128278369-128278391 CTTCCCACATGCCCTGAACCAGG - Intronic
938298491 2:130193665-130193687 ATGCCCACATGCCTAGCCCATGG + Intronic
938458241 2:131480848-131480870 ATGCCCACATGCCTAGCCCATGG - Intronic
938747035 2:134289197-134289219 CTTCCCACATGCCCTTTGCTCGG + Intronic
940333185 2:152497954-152497976 CTGCCCACATGACCTCTCCCTGG + Intronic
940764197 2:157772231-157772253 CTGCCCAAAAGCCCTGGCCATGG + Intronic
941698184 2:168575829-168575851 CTGCCCACCTGCCCCAACCTGGG + Intronic
943369560 2:187001371-187001393 CTGCCCACTTCCCCGGCCCTGGG - Intergenic
943666559 2:190615434-190615456 CTTCACATGTGCCCTGCCCTGGG - Intergenic
946345567 2:219107711-219107733 CATACCACATGCCCTGCTCTGGG + Intronic
947119592 2:226800429-226800451 CTGCCCCCAGTCACTGCCCTTGG - Intergenic
947668542 2:231922573-231922595 CTAACCACAGGCCTTGCCCTTGG + Intronic
947744552 2:232500840-232500862 CTGCCTCCTGGCCCTGCCCTGGG - Intergenic
947931500 2:233968595-233968617 CTGGGCACCTGCCCTGCCCTTGG - Intronic
948195284 2:236091080-236091102 CTGCCTGCATGCCCTGTCCTTGG + Intronic
948262042 2:236611708-236611730 CAGCCCTCATGACTTGCCCTGGG - Intergenic
948461982 2:238134235-238134257 CTGCCCACTCGCTATGCCCTTGG + Intergenic
948485258 2:238276749-238276771 GTGCCCACATGCCCTGGACAAGG + Intronic
948771865 2:240255292-240255314 CTGCCCAGTTCCTCTGCCCTTGG + Intergenic
948787960 2:240362885-240362907 CCGACCACCTGCCCAGCCCTGGG + Intergenic
948789211 2:240368729-240368751 CTGTCCCCAGGCTCTGCCCTGGG - Intergenic
948789223 2:240368768-240368790 GTGCCCCCAGGCTCTGCCCTGGG - Intergenic
949025112 2:241764122-241764144 CTGAACACATCCCCTGCCCGGGG - Intronic
1169340926 20:4795667-4795689 CTGCCCACCTGCCTTAGCCTTGG - Intronic
1169513484 20:6291626-6291648 CTGCCCCCATGCCATGCTCAAGG + Intergenic
1169555289 20:6743118-6743140 CTGCCCAGATGCCTTGCCTTTGG - Intergenic
1169607646 20:7340374-7340396 GTGCCAACATACACTGCCCTGGG + Intergenic
1170556402 20:17518530-17518552 CTGCCCACTTCCCCTGCGGTAGG - Intronic
1170582661 20:17710872-17710894 CTGCCCACACACCCAGCCCTGGG - Intronic
1171155066 20:22864475-22864497 CAGCCCACATGCCCAGCAATTGG - Intergenic
1171266193 20:23773941-23773963 ATGCCTGCATGCCCTGCTCTAGG + Intergenic
1171275949 20:23856579-23856601 ATGCCTGCATGCCCTGCTCTAGG + Intergenic
1171424440 20:25040820-25040842 CTGCCCAGATGCCCCACCCCAGG + Intronic
1171782029 20:29427955-29427977 CTCCCCCCCTGCCCTGCCCCTGG + Intergenic
1172007776 20:31829303-31829325 CAGCCCACAGGCCATGTCCTGGG + Intronic
1172185201 20:33027252-33027274 CTTTCCACATGGCCTGCCCAGGG - Intergenic
1172477821 20:35252141-35252163 ATGCCCACATGCCTGGCTCTTGG - Intronic
1172778723 20:37423228-37423250 TTGCCCCCTTGCCCTGGCCTGGG + Intergenic
1172951121 20:38724152-38724174 CCCCCCACCTCCCCTGCCCTCGG + Intergenic
1173789493 20:45818549-45818571 ATGGCCACATGGCCTGCCTTGGG + Intergenic
1174374232 20:50114779-50114801 GAGCCACCATGCCCTGCCCTAGG - Intronic
1174393870 20:50234126-50234148 CTGCCCACCCCCACTGCCCTGGG - Intergenic
1174438116 20:50526482-50526504 CTGCCCAAATGCACTGACATGGG - Intronic
1174628417 20:51935179-51935201 CCTCCTCCATGCCCTGCCCTGGG - Intergenic
1175300663 20:57940589-57940611 CTGGGCACCAGCCCTGCCCTGGG - Intergenic
1175400280 20:58696297-58696319 CTGCCCACATTCCCTCCCCAGGG + Intronic
1175499765 20:59441514-59441536 CTGCCCACATGGTCTCCCCTTGG + Intergenic
1175908070 20:62391617-62391639 CTGCCCATGCGCCCTGCCCTGGG - Intronic
1175925890 20:62471162-62471184 CTGCTGCCCTGCCCTGCCCTGGG - Intronic
1175943149 20:62547130-62547152 CTGCCCAGCTGCGGTGCCCTGGG - Intergenic
1176072602 20:63234904-63234926 CTGCCCACCTGCGCTCCCCGTGG + Intergenic
1176220662 20:63968014-63968036 CTGCCCTGGAGCCCTGCCCTTGG + Intronic
1176603527 21:8812668-8812690 CTACCCATAAGCCCTGCACTGGG - Intergenic
1178376206 21:32069779-32069801 TTACCCACATGCCCTGCTCCCGG + Intergenic
1178554819 21:33580323-33580345 CTGACCTCATGATCTGCCCTCGG - Intronic
1178626183 21:34220785-34220807 CTTCCCTGAGGCCCTGCCCTGGG + Intergenic
1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG + Intergenic
1179809944 21:43864537-43864559 CGGCCCACGTGCCGCGCCCTTGG - Intergenic
1180139744 21:45886228-45886250 CTCACCACATCCTCTGCCCTTGG - Intronic
1180139757 21:45886280-45886302 CTCACCACATCCTCTGCCCTTGG - Intronic
1180139780 21:45886381-45886403 CTCACCACATCCTCTGCCCTTGG - Intronic
1180139791 21:45886430-45886452 CTCACCACATCCTCTGCCCTTGG - Intronic
1180139816 21:45886534-45886556 CTCACCACATCCTCTGCCCTTGG - Intronic
1180139843 21:45886638-45886660 CTCACCACATCCTCTGCCCTTGG - Intronic
1180181913 21:46121843-46121865 CTGCCCTCAGGCCCTGCCTCAGG - Intronic
1180336088 22:11578018-11578040 CTGTTCACCTGGCCTGCCCTAGG + Intergenic
1180345810 22:11704225-11704247 CTACCCATAAGCCCTGCACTGGG - Intergenic
1180801664 22:18634747-18634769 CTGCTCACTTGCCCCGTCCTGGG - Intergenic
1180852908 22:19030286-19030308 CTGCTCACTTGCCCCGTCCTGGG - Intergenic
1181220059 22:21360514-21360536 CTGCTCACTTGCCCCGTCCTGGG + Intergenic
1181408899 22:22704378-22704400 CTGCCCCCAGACCCTGCCCCAGG + Intergenic
1181534612 22:23534956-23534978 CTTCCCACATGCCCGGGCCCTGG - Intergenic
1181615921 22:24054396-24054418 CTCCCCATAGGCCCTGCCCATGG + Intronic
1181687741 22:24541287-24541309 CTGCCACCATGCCATGCCTTGGG + Intronic
1181983346 22:26782033-26782055 CTGCCCTCCTTCCCTGCCCTGGG + Intergenic
1182143302 22:27981044-27981066 CTGCCCCCAGGCCCTCACCTTGG - Exonic
1182800861 22:33031111-33031133 CTGGCCATCTGCCCTGCCTTAGG - Intronic
1182931309 22:34176819-34176841 CGGGTCACAAGCCCTGCCCTTGG + Intergenic
1183385199 22:37510186-37510208 GTGCCCACAAGCCCTGGCCCTGG + Intronic
1183456498 22:37925908-37925930 CTGGCCACCAGCCCTGCCCTGGG + Exonic
1183727418 22:39597461-39597483 GTGCCCAGAGGCCCTGCCCAAGG + Intronic
1183750768 22:39719181-39719203 CTGCTCACACTCCCTGCCCAGGG + Intergenic
1184118360 22:42434924-42434946 CTGAACACCTGCCCTGCCCTGGG + Intergenic
1184508434 22:44917986-44918008 CTGGCCACATCGCCTGCCCGTGG - Intronic
1185041010 22:48504388-48504410 CTGCCCCCCTGCCCAGCCCCCGG - Intronic
1185058295 22:48592476-48592498 CTTGCCTCATGCCCAGCCCTGGG + Intronic
1185219571 22:49622645-49622667 CTGCCCACCTCTCCTGCCCCCGG - Intronic
1185284979 22:49996081-49996103 CTGCCCACAGGACATGCCCAGGG - Exonic
1185370063 22:50456768-50456790 CTGCCAACCACCCCTGCCCTGGG - Intronic
949324445 3:2847851-2847873 CTGCCCACATGCTCTTACCGGGG + Intronic
950554631 3:13687921-13687943 CTGCCTGCATGCCCTGTCCTGGG - Intergenic
951169187 3:19519213-19519235 CTGCCCACATGCCCTTGCCTGGG - Intronic
952324911 3:32312487-32312509 CTGCCCACATGCCTTGCCCTGGG - Intronic
953561970 3:43998913-43998935 CTGTCCTCTCGCCCTGCCCTTGG - Intergenic
954295231 3:49670785-49670807 CAGACCACATGCTCTGCCCAAGG - Exonic
954841102 3:53512549-53512571 CCGCCAGCATGACCTGCCCTGGG + Intronic
955206731 3:56902742-56902764 CTGCTCACATGTCCTCACCTGGG - Intronic
955958819 3:64318124-64318146 CTGACCACATGCCAGGCACTGGG + Intronic
956717085 3:72088175-72088197 GTGCCCACTGGCCCTGCCCCAGG - Intergenic
956779725 3:72594383-72594405 CTGGCTACATTTCCTGCCCTCGG - Intergenic
957712212 3:83875944-83875966 GTGCCGTCCTGCCCTGCCCTGGG + Intergenic
960094024 3:113670832-113670854 CTGCCCTCAGCCCCTTCCCTGGG + Intronic
960738285 3:120804298-120804320 CTTCCCACATGCCTTGCCCTAGG - Intergenic
960823314 3:121757484-121757506 CTGTATACTTGCCCTGCCCTGGG + Intergenic
960961228 3:123071825-123071847 CTGACGACATGCCAGGCCCTGGG - Intronic
961300078 3:125916531-125916553 CTGCCCCCGCGCACTGCCCTGGG + Intergenic
961411152 3:126721342-126721364 CTTCCCCGGTGCCCTGCCCTAGG + Intronic
961635958 3:128332777-128332799 CTGTCCTCATGCACAGCCCTAGG + Intronic
961653578 3:128429420-128429442 CTGCCCCCATCCCGGGCCCTGGG + Intergenic
964875169 3:161359011-161359033 TTGTCCACATCCCCTACCCTTGG + Intronic
965732246 3:171784539-171784561 CTGCACACATGCCATGTCCCAGG + Intronic
966811100 3:183845690-183845712 CTGCCCGCCTGCCCTTCCCAGGG - Intronic
966868668 3:184276342-184276364 CTTCCCACCTGCCCTGCTCTCGG - Intronic
966988943 3:185209010-185209032 CTACTCACATCCCCAGCCCTAGG - Intronic
967133353 3:186492907-186492929 CTGCCCACAGCTGCTGCCCTCGG + Intergenic
968083585 3:195863825-195863847 GTACCCCCAGGCCCTGCCCTGGG - Exonic
968274244 3:197427828-197427850 CTGTCCACTTTCCCAGCCCTGGG + Intergenic
968479865 4:828544-828566 ATGCCCACTTTCCCTTCCCTAGG - Intergenic
968581974 4:1399421-1399443 CTGCCCACACCCCCAGCCCCAGG - Intergenic
968865817 4:3210586-3210608 CTGCTCACAGGACCTGCCCACGG - Intronic
968914604 4:3491982-3492004 CTCCCCTCCTGCCCTGCCCCAGG + Intronic
968921049 4:3522530-3522552 CATCCCACACGCCCTGCCCGGGG + Intronic
968977899 4:3831322-3831344 CTGCCCACTTGTCCTCCCCCAGG - Intergenic
969172714 4:5376845-5376867 CTGGCCCCATGCTCTGCCCTCGG + Intronic
969572893 4:8020419-8020441 CAGCCCAGATCCCCTGCCCAGGG + Intronic
969756431 4:9153203-9153225 CTGCCCCCGCGCACTGCCCTCGG + Intergenic
972285711 4:37645960-37645982 CTGCCCTCAGGCCCTGCCCTGGG - Intronic
972510283 4:39762860-39762882 CTGACCTCATGATCTGCCCTCGG + Intronic
973345306 4:49048611-49048633 GTGCCCACATGGCCTTTCCTTGG + Intronic
976604270 4:86968077-86968099 CTCCCCACCTGCTCTTCCCTTGG - Intronic
977758066 4:100697196-100697218 CTGCCCCCATCCCCTGCCTGTGG - Intronic
979488523 4:121297009-121297031 CTGCTCCCATGCCCAGCCCTTGG - Intergenic
980626494 4:135380748-135380770 CTGCCCTGTTCCCCTGCCCTGGG + Intergenic
981939138 4:150262876-150262898 CTGACCTCATGCCCTGCTCACGG + Intergenic
983303024 4:165951498-165951520 CTGACCACATTCACTGCCCATGG - Intronic
986043603 5:4016782-4016804 CTGCCCACCTGGCCTGCACTAGG - Intergenic
986614532 5:9602696-9602718 CTGCCCAGAAGCCCTTTCCTGGG - Intergenic
986710875 5:10487046-10487068 CCACCCTCATGCCCTGGCCTAGG + Intergenic
987300913 5:16597603-16597625 CTTCCAACCTGCACTGCCCTTGG + Intronic
987871133 5:23618259-23618281 CTGGCCCCTTGCCCTTCCCTGGG + Intergenic
990044664 5:51414567-51414589 CTGCCCACTTCCCCAGCTCTTGG + Intergenic
990229709 5:53699473-53699495 CTCCCCAAATCCCCTGCCCCTGG - Intergenic
990506334 5:56449109-56449131 TTTCCCAGATGACCTGCCCTTGG + Intergenic
990666871 5:58082572-58082594 CACCTCAAATGCCCTGCCCTCGG - Intergenic
991247168 5:64520698-64520720 CTGCTAACATGTCCTACCCTGGG - Intronic
992196027 5:74340016-74340038 CTCCCCAAACGCTCTGCCCTTGG + Intergenic
992432408 5:76722193-76722215 CTGTCCCCATCCCCAGCCCTGGG + Intronic
994210575 5:97083946-97083968 CTGCTCTCATTCCCTGCCCCGGG - Intergenic
996633302 5:125663239-125663261 CTGCCCCCTTGCCTTGCCTTTGG - Intergenic
997515901 5:134489820-134489842 CTGCCAACAAGCCCAGCCTTGGG + Intergenic
998353530 5:141516191-141516213 CTGCCCACAGGCTCTGGCCTGGG + Exonic
998512460 5:142724854-142724876 CTGCCCGAATGCCCGTCCCTGGG - Intergenic
1000264220 5:159619457-159619479 CAGCCTACCTGCCCTGCCCCCGG + Intergenic
1000660543 5:163933247-163933269 CTGCACAGATGTCCTGCCCAGGG - Intergenic
1001001819 5:168014781-168014803 CTGCCCGCAACCCCTGCCCAGGG + Intronic
1001312925 5:170624025-170624047 CTGGCCTGATGCCCTGACCTGGG + Intronic
1001535583 5:172495577-172495599 CTGCTGACCTGACCTGCCCTGGG - Intergenic
1001557626 5:172647326-172647348 CTGCACACCTGCCCTGCACTAGG + Intronic
1001966447 5:175913230-175913252 CTGCCCAGATGCTTTTCCCTTGG - Intergenic
1001990509 5:176112410-176112432 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1002044638 5:176535029-176535051 CTTACCACCTTCCCTGCCCTGGG - Intronic
1002065675 5:176650549-176650571 CCTCCCACTTGGCCTGCCCTTGG - Intronic
1002077034 5:176714399-176714421 CGGCTCACATGCCCCTCCCTAGG + Intergenic
1002226363 5:177725730-177725752 CTGCCCAGAGGCTCTGCCCTGGG + Intronic
1002250500 5:177925974-177925996 CTGCCCAGATGCTTTTCCCTTGG + Intergenic
1002267484 5:178045483-178045505 CTGCCCAGAGGCTCTGCCCTGGG - Intronic
1002298976 5:178247037-178247059 CTGCCTGCATGCCCTGCCCCAGG - Intronic
1002305035 5:178278251-178278273 CTGCCCTCCTGCCCCACCCTTGG + Intronic
1002445159 5:179286244-179286266 CTGTCGACAGGCCCTCCCCTGGG + Intronic
1003181894 6:3799361-3799383 CTGTGCCCATGCCCTGCCCTGGG + Intergenic
1003556257 6:7142334-7142356 CTTCCCAGCTGCGCTGCCCTCGG + Intronic
1004793119 6:19051033-19051055 CTGCCCACCAGCCCTTCCCAGGG + Intergenic
1006295484 6:33168329-33168351 CTGCACACACACCCTGCCCCGGG + Intronic
1009539875 6:64941094-64941116 GAGCCACCATGCCCTGCCCTTGG - Intronic
1010891114 6:81312203-81312225 CTGGTCACAGACCCTGCCCTGGG + Intergenic
1011513570 6:88127737-88127759 CTGCACACATGGTCTGCCTTGGG - Intergenic
1012409588 6:98941603-98941625 CTGCCCACTTGTTCTGCCCAGGG + Intronic
1013107989 6:107042375-107042397 CAGCCCACAGGCCCCACCCTTGG + Intronic
1015312742 6:131783074-131783096 CTGCCCACTTATCTTGCCCTGGG - Intergenic
1015577608 6:134689842-134689864 CTGGCTGCATGCACTGCCCTGGG + Intergenic
1017155900 6:151322530-151322552 TTGCCCAAATGTCCTGCTCTTGG + Intronic
1017548701 6:155480935-155480957 CAGCCCACATGTGCTGCCATTGG + Intergenic
1019334584 7:476966-476988 CAGGCCACACGCCCTGCCCGTGG + Intergenic
1019751773 7:2735167-2735189 CTGCTCTCCTGCCCTCCCCTGGG + Intronic
1020235094 7:6348997-6349019 CGGCCCACAGGCCCCGCCCCTGG + Intergenic
1020678488 7:11207798-11207820 GTGCCCACATCACATGCCCTTGG - Intergenic
1022301346 7:29105539-29105561 CAGACCACATGTCCAGCCCTTGG + Intronic
1022525281 7:31033243-31033265 CTCCCCAGATGCCCTACCTTGGG - Intergenic
1023126946 7:36963808-36963830 CTGCCCTTCTGCCCTGCCCCTGG + Intronic
1023865244 7:44235285-44235307 CTGCCCAGCAGCCCTGGCCTTGG + Intronic
1024574680 7:50754218-50754240 CTGCCCTAGAGCCCTGCCCTGGG + Intronic
1025664409 7:63574678-63574700 CCGCCCACCACCCCTGCCCTGGG + Intergenic
1025978443 7:66388118-66388140 CTCCCCACTTACCTTGCCCTGGG + Intronic
1026953855 7:74364551-74364573 CCCCCCATCTGCCCTGCCCTGGG - Intronic
1027204023 7:76082789-76082811 CTCCCCACTTACCCTGCCCCGGG + Intergenic
1028712955 7:93931539-93931561 CTGCCTAGATAGCCTGCCCTGGG + Intergenic
1028868228 7:95737453-95737475 CTGCCCACATACTCCTCCCTGGG - Intergenic
1029232153 7:99079163-99079185 GTGGCCACACGCCCTGCCCGAGG - Intronic
1029284437 7:99456111-99456133 CTGGACACATGGCCTGCCCAGGG - Intronic
1029419742 7:100466591-100466613 CTGTCCACACTCCCTCCCCTGGG + Exonic
1029460656 7:100692346-100692368 TTGCCCACTTGCCCAGCCTTGGG + Intergenic
1032018099 7:128392513-128392535 CTGCCCCCTTCCCCGGCCCTGGG - Exonic
1032089450 7:128903993-128904015 CTGGACACCTGCCCTGCCCTGGG - Intronic
1032577355 7:133069334-133069356 CTGCCCAAATGCCATTCACTTGG - Intronic
1034331392 7:150286268-150286290 CTGCTCACAGGCCCTTCGCTGGG + Intronic
1034666652 7:152823592-152823614 CTGCTCACAGGCCCTTCGCTGGG - Intronic
1034859187 7:154581566-154581588 CTGTCCACATGATCTGACCTGGG + Intronic
1035238930 7:157517557-157517579 CCGACCACAAGCCCTGCCCCAGG - Intergenic
1035375969 7:158407088-158407110 CTGCAGACAAGCCCAGCCCTGGG + Intronic
1035387678 7:158485104-158485126 CGACCCACAAGCCCTGCGCTCGG - Intronic
1036231307 8:7001884-7001906 CTGCCCATATGTCCTGGCCCAGG + Intronic
1036630620 8:10511700-10511722 CTTCCCCCATACCTTGCCCTGGG - Intergenic
1036731116 8:11265718-11265740 CTCCCTTCATGCCCTGCGCTGGG - Intergenic
1036744014 8:11391222-11391244 CTGCACACATGCATTGCCCGGGG - Intronic
1036849898 8:12194142-12194164 CTGCCCCCGCGCTCTGCCCTCGG - Intergenic
1036871262 8:12436415-12436437 CTGCCCCCGCGCACTGCCCTCGG - Intergenic
1037818917 8:22126255-22126277 TTGCCCAAATGCCCTGCACCTGG - Intronic
1038725957 8:30082861-30082883 CTGACCGCGGGCCCTGCCCTGGG - Exonic
1039418489 8:37416499-37416521 CTGCCCACTTGCCTTGCTCTGGG - Intergenic
1039634525 8:39148588-39148610 CAGACCAAAAGCCCTGCCCTCGG - Intronic
1040436905 8:47399657-47399679 CTGCCCACATGGGCAGCCCAAGG - Intronic
1041019786 8:53627192-53627214 CTTCCCACATGCCGTGAACTGGG + Intergenic
1041090784 8:54299346-54299368 CAGCCCAGAAGCCCAGCCCTCGG - Intergenic
1042642975 8:70955738-70955760 CTGCACACCTGGCCTGCCCTTGG - Intergenic
1045484753 8:102622226-102622248 CTGGGCTCCTGCCCTGCCCTTGG + Intergenic
1045872949 8:106946815-106946837 ACCCCCACATGCCCTGCCATGGG + Intergenic
1046767413 8:118084682-118084704 CTTCCCTAATGCCATGCCCTAGG - Intronic
1047205544 8:122800307-122800329 CTGCCCTCTTCCCCTGTCCTGGG + Intronic
1047251101 8:123182611-123182633 AGGGCCACCTGCCCTGCCCTCGG - Exonic
1047275614 8:123402563-123402585 CTGCCCCCTTCCCCGGCCCTGGG + Intronic
1047760633 8:127951409-127951431 CTACCCACTGGCCTTGCCCTGGG - Intergenic
1048175210 8:132145972-132145994 TTGGCCACATGCCCTCCCTTTGG - Intronic
1048205583 8:132412720-132412742 ATGGCCACCTCCCCTGCCCTGGG + Intronic
1049151985 8:141040943-141040965 CTTCCTGCATGCCCTGCCCCAGG - Intergenic
1049202428 8:141346878-141346900 CTGAGCACAAGCCCTCCCCTAGG + Intergenic
1049453638 8:142676079-142676101 CCGGCCTCATGCCCTGCACTAGG + Intronic
1049733424 8:144190984-144191006 CTCCCCACATTCCCTGCCCGTGG + Intronic
1049785508 8:144448821-144448843 CAGGCCACACGCCCTGGCCTGGG + Intergenic
1049833892 8:144720566-144720588 ATGCCCAAATACCCTGCCATGGG + Intergenic
1049847608 8:144810639-144810661 CTGCCCACATGCCCGCCACTGGG + Intronic
1050608905 9:7330801-7330823 CTTCCAACCTGTCCTGCCCTTGG - Intergenic
1052916390 9:33926941-33926963 CTGCCCAGCTCCCCTGGCCTCGG - Intronic
1052941075 9:34132688-34132710 CTGCCCTCTTCCCCGGCCCTGGG - Intergenic
1053752048 9:41266724-41266746 CTCCACACATGCCCAGCCCCTGG + Intergenic
1055040480 9:71865630-71865652 CTGACCTCATGATCTGCCCTTGG - Intronic
1056037236 9:82619420-82619442 ATGCCAACATGGCCTGCCATGGG + Intergenic
1056595870 9:88007208-88007230 TCACCCCCATGCCCTGCCCTCGG + Intergenic
1056745284 9:89296232-89296254 CTGCCCCCAACACCTGCCCTTGG - Intergenic
1056901845 9:90607174-90607196 CTGCCCACATGCTCTACCCTGGG - Intergenic
1057046684 9:91891717-91891739 CTGCCCACATTCCCGGCCCTGGG + Intronic
1059407769 9:114112553-114112575 CTGCCTACAAGCCCTGCCTGAGG + Intergenic
1059628733 9:116096438-116096460 CTGCACACCTGCCAAGCCCTTGG + Intergenic
1060649824 9:125315820-125315842 CTGAGCACATGACCAGCCCTGGG - Intronic
1061233645 9:129329322-129329344 CTGACCACGTGATCTGCCCTCGG - Intergenic
1061709877 9:132480251-132480273 CTGCCCACCCACCCTGCTCTGGG + Intronic
1061774000 9:132948607-132948629 CTGGCCAGGTGCCCTGCCGTTGG + Intronic
1061780098 9:132990790-132990812 CTGCTCCCCTGCCCTGCCCCCGG - Intronic
1061940390 9:133880835-133880857 CTGCCCACCTGACCTGCCAAAGG - Intronic
1061941233 9:133885228-133885250 CTGCATACATGCCCTTCCCTGGG - Intronic
1062232602 9:135490441-135490463 CTGCCCCCATGCCCACCCCAGGG + Intergenic
1062270806 9:135707493-135707515 CGGCCCACAGCCCCTGCCCCCGG - Intronic
1062406549 9:136399602-136399624 CAGCCCTCATGACCAGCCCTTGG - Intergenic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1062501455 9:136853706-136853728 CTGCCCACCCGCCCTCCCCTTGG - Intronic
1062724216 9:138062218-138062240 CTGACCAGATACCCTGCCCAGGG + Intronic
1185624257 X:1471643-1471665 CTTCCCTCATTCCCAGCCCTGGG + Intronic
1187312631 X:18160316-18160338 CTGCCCACATGTCTGGCCATGGG + Intergenic
1188199982 X:27285341-27285363 CTGCCCACATTGCCTGCCAGTGG - Intergenic
1189316081 X:40057521-40057543 CTGCCCAGCTGCCTGGCCCTGGG + Intronic
1190873734 X:54445558-54445580 CTGCCCGCTGGCCCTGCCATGGG + Exonic
1190983545 X:55480207-55480229 CTGACAAAATGCCCTTCCCTAGG + Intergenic
1191257224 X:58284850-58284872 CTGCCACCATGCCCGACCCTTGG - Intergenic
1194212328 X:91083421-91083443 CTCCACACCTGCCTTGCCCTTGG + Intergenic
1195719343 X:107851522-107851544 CTTCCCCCATCCCCTGCCCTGGG + Intronic
1197281782 X:124545384-124545406 TTGCTCACATGCTCTGCTCTGGG + Intronic
1198842773 X:140876664-140876686 CTCCCCCCATGCCTTGCCCTAGG + Intergenic
1199979414 X:152912794-152912816 CTGCACATGTGCCCTGCCCATGG + Intergenic
1200073128 X:153538694-153538716 CTGCCCCCATGCCCTGGACCTGG + Intronic
1202232808 Y:22672551-22672573 CAGGCCACATGCCCTGCCCATGG - Intergenic
1202310348 Y:23523607-23523629 CAGGCCACATGCCCTGCCCATGG + Intergenic
1202560454 Y:26146987-26147009 CAGGCCACATGCCCTGCCCATGG - Intergenic