ID: 925360805

View in Genome Browser
Species Human (GRCh38)
Location 2:3278789-3278811
Sequence GTTGCCAGTTATGGGGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 799}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925360805_925360822 23 Left 925360805 2:3278789-3278811 CCAGCAACCCCATAACTGGCAAC 0: 1
1: 0
2: 1
3: 29
4: 799
Right 925360822 2:3278835-3278857 CCTGTGCAGGGAGGAGGTCACGG 0: 1
1: 2
2: 0
3: 53
4: 490
925360805_925360816 10 Left 925360805 2:3278789-3278811 CCAGCAACCCCATAACTGGCAAC 0: 1
1: 0
2: 1
3: 29
4: 799
Right 925360816 2:3278822-3278844 CCACAGAGGCTGCCCTGTGCAGG 0: 1
1: 0
2: 6
3: 39
4: 327
925360805_925360817 11 Left 925360805 2:3278789-3278811 CCAGCAACCCCATAACTGGCAAC 0: 1
1: 0
2: 1
3: 29
4: 799
Right 925360817 2:3278823-3278845 CACAGAGGCTGCCCTGTGCAGGG 0: 1
1: 0
2: 8
3: 60
4: 375
925360805_925360818 14 Left 925360805 2:3278789-3278811 CCAGCAACCCCATAACTGGCAAC 0: 1
1: 0
2: 1
3: 29
4: 799
Right 925360818 2:3278826-3278848 AGAGGCTGCCCTGTGCAGGGAGG 0: 1
1: 1
2: 3
3: 66
4: 615
925360805_925360825 26 Left 925360805 2:3278789-3278811 CCAGCAACCCCATAACTGGCAAC 0: 1
1: 0
2: 1
3: 29
4: 799
Right 925360825 2:3278838-3278860 GTGCAGGGAGGAGGTCACGGGGG 0: 1
1: 0
2: 1
3: 36
4: 413
925360805_925360819 17 Left 925360805 2:3278789-3278811 CCAGCAACCCCATAACTGGCAAC 0: 1
1: 0
2: 1
3: 29
4: 799
Right 925360819 2:3278829-3278851 GGCTGCCCTGTGCAGGGAGGAGG 0: 1
1: 1
2: 11
3: 97
4: 714
925360805_925360826 27 Left 925360805 2:3278789-3278811 CCAGCAACCCCATAACTGGCAAC 0: 1
1: 0
2: 1
3: 29
4: 799
Right 925360826 2:3278839-3278861 TGCAGGGAGGAGGTCACGGGGGG 0: 1
1: 0
2: 5
3: 32
4: 355
925360805_925360823 24 Left 925360805 2:3278789-3278811 CCAGCAACCCCATAACTGGCAAC 0: 1
1: 0
2: 1
3: 29
4: 799
Right 925360823 2:3278836-3278858 CTGTGCAGGGAGGAGGTCACGGG 0: 1
1: 0
2: 4
3: 40
4: 392
925360805_925360809 -4 Left 925360805 2:3278789-3278811 CCAGCAACCCCATAACTGGCAAC 0: 1
1: 0
2: 1
3: 29
4: 799
Right 925360809 2:3278808-3278830 CAACCCCATAAGCCCCACAGAGG 0: 1
1: 0
2: 1
3: 19
4: 132
925360805_925360824 25 Left 925360805 2:3278789-3278811 CCAGCAACCCCATAACTGGCAAC 0: 1
1: 0
2: 1
3: 29
4: 799
Right 925360824 2:3278837-3278859 TGTGCAGGGAGGAGGTCACGGGG 0: 1
1: 0
2: 1
3: 31
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925360805 Original CRISPR GTTGCCAGTTATGGGGTTGC TGG (reversed) Intronic
900075454 1:812810-812832 GTTACCAGGTCTGGGGGTGCTGG + Intergenic
900758256 1:4452757-4452779 ATTCCCAGTAATGGGATTGCTGG - Intergenic
900820851 1:4886875-4886897 ATACCCAGTAATGGGGTTGCTGG + Intergenic
900992906 1:6106183-6106205 TTTGCCAGCAATGGGGTGGCGGG + Intronic
902107350 1:14048780-14048802 ATAGCCAGTAATGGGATTGCTGG + Intergenic
902342629 1:15794058-15794080 GTTCCCAGGTATGGAATTGCAGG - Intergenic
902723955 1:18323022-18323044 GGTGACAGATATGGGGTCGCTGG - Intronic
902744205 1:18462514-18462536 ATACCCAGTAATGGGGTTGCTGG - Intergenic
903391973 1:22971067-22971089 GGTGCCAGTTAGGGGATAGCAGG - Intergenic
903562499 1:24238368-24238390 GGTGCCAGTTGTGGGGTGGCGGG + Intergenic
904414386 1:30348061-30348083 ATACCCAGTTATGGGATTGCTGG + Intergenic
906015099 1:42569607-42569629 ATAGCCAGTAATGGGATTGCTGG - Intronic
906189159 1:43884845-43884867 GCTTCCAGATATGGGTTTGCTGG - Intronic
906449757 1:45934911-45934933 ATTTCCAATGATGGGGTTGCTGG + Intronic
906840440 1:49132870-49132892 ATTCCCAGTAATGGGATTGCTGG - Intronic
906867946 1:49442766-49442788 ATTCCCAGTAATGGGATTGCTGG + Intronic
906891065 1:49715475-49715497 GTACCCAGTTATGGGATTGCTGG + Intronic
906954829 1:50365056-50365078 ATGTCCAGTAATGGGGTTGCTGG - Intergenic
907577029 1:55535729-55535751 ATAGCCAGTAATGGGATTGCTGG - Intergenic
907711540 1:56887213-56887235 TTTTCCAGTAATGGGATTGCTGG + Intronic
907813064 1:57891489-57891511 ATAGCCAGTAATGGGATTGCTGG - Intronic
908083576 1:60606922-60606944 GTATCCAGTAATGGGATTGCTGG - Intergenic
908937126 1:69389600-69389622 GGGGCCTGTTGTGGGGTTGCGGG - Intergenic
909064349 1:70916361-70916383 GTACCCAGTAATGGGATTGCTGG - Intronic
909136883 1:71812407-71812429 GTACCCAGTAATGGGATTGCTGG + Intronic
909596222 1:77409273-77409295 ATGCCCAGTAATGGGGTTGCTGG + Intronic
909813807 1:79964700-79964722 ATATCCAGTAATGGGGTTGCTGG + Intergenic
910009137 1:82439025-82439047 ATAGCCAGTAATGGGATTGCTGG - Intergenic
910223118 1:84909089-84909111 ATAGCCAGTAATGGGATTGCTGG - Intergenic
910452916 1:87365102-87365124 ATTCCCAGTAATGGGATTGCTGG + Intergenic
910560760 1:88588240-88588262 ATACCCAGTAATGGGGTTGCTGG - Intergenic
911001910 1:93175000-93175022 GTACCCAGTAATGGGATTGCTGG + Intronic
911495407 1:98624951-98624973 GAAGCCAGTTAGGGGGTAGCTGG - Intergenic
911842965 1:102707964-102707986 ATAGCCAGTAATGGGATTGCTGG - Intergenic
912098300 1:106172994-106173016 AATGCCAGTAATGGGATTGCTGG - Intergenic
912205486 1:107503810-107503832 ATACCCAGTAATGGGGTTGCTGG + Intergenic
912594671 1:110862296-110862318 ATAGCCAGTAATGGGATTGCTGG + Intergenic
912595228 1:110869195-110869217 GTACCCAGTAATGGGATTGCTGG - Intergenic
914400202 1:147312306-147312328 ATACCCAGTAATGGGGTTGCTGG - Intergenic
915792392 1:158688058-158688080 ATAGCCAGTAATGGGATTGCTGG + Intergenic
915887839 1:159741920-159741942 ATACCCAGTAATGGGGTTGCTGG + Intergenic
916612151 1:166402794-166402816 ATAGCCAGTAATGGGATTGCTGG + Intergenic
916864285 1:168838503-168838525 GTACCCAGTAATGGGATTGCTGG - Intergenic
916984012 1:170170885-170170907 GTACCCAGTAATGGGATTGCTGG + Intergenic
916992652 1:170260988-170261010 GGGGCCAGTTGTGGGGTGGCGGG + Intergenic
917230328 1:172829709-172829731 GTACCCAGTAATGGGATTGCTGG + Intergenic
917232459 1:172852898-172852920 GTACCCAGTAATGGGATTGCTGG + Intergenic
917263737 1:173197316-173197338 ATACCCAGTAATGGGGTTGCTGG - Intronic
917559203 1:176127754-176127776 ATTCCCAGTAATGGGATTGCAGG + Intronic
918500952 1:185195508-185195530 GTACCCAGTAATGGGATTGCTGG + Intronic
919203774 1:194393770-194393792 GTATCCAGTAATGGGATTGCTGG - Intergenic
921336982 1:214098033-214098055 GTACCCAGTAATGGGATTGCTGG - Intergenic
921840999 1:219828197-219828219 ATAGCCAGTAATGGGATTGCTGG + Intronic
921860329 1:220036313-220036335 ATAGCCAGTAATGGGATTGCTGG - Intronic
921947741 1:220897972-220897994 GTACCCAGTAATGGGATTGCTGG + Intergenic
921975557 1:221199178-221199200 ATATCCAGTAATGGGGTTGCTGG - Intergenic
922271297 1:224037684-224037706 GTTACCAGGTCTGGGGGTGCTGG + Intergenic
922390139 1:225132729-225132751 GTACCCAGTAATGGGATTGCTGG + Intronic
922391505 1:225148144-225148166 ATAGCCAGTAATGGGATTGCTGG + Intronic
923607357 1:235456628-235456650 GATGCCAGCTATGGGGACGCAGG + Intronic
923828428 1:237526030-237526052 GTATCCAGTTGTGGGATTGCAGG + Intronic
923928964 1:238671284-238671306 ATATCCAGTTATGGGATTGCCGG - Intergenic
924063729 1:240203290-240203312 ATATCCAGTAATGGGGTTGCTGG - Intronic
924109237 1:240681578-240681600 GTACCCAGTAATGGGATTGCTGG - Intergenic
924767136 1:247044436-247044458 GTATCCAGTAATGGGATTGCTGG - Intronic
1062929500 10:1343503-1343525 ATACCCAGTAATGGGGTTGCTGG - Intronic
1063465232 10:6239079-6239101 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1063765836 10:9139272-9139294 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1063796336 10:9517559-9517581 GTTCCCAGTCATGGGGGTGGGGG - Intergenic
1063855457 10:10246723-10246745 GTGCCCAGTAATGGGATTGCTGG + Intergenic
1064136541 10:12755511-12755533 ATACCCAGTAATGGGGTTGCTGG + Intronic
1064507903 10:16053590-16053612 GTGCCCAGTAATGGGATTGCTGG + Intergenic
1064700905 10:18020480-18020502 ATAGCCAGTAATGGGATTGCTGG + Intronic
1065261652 10:23929815-23929837 ATACCCAGTGATGGGGTTGCTGG + Intronic
1065278203 10:24107394-24107416 GTGCCCAGTAATGGGGTTGCTGG + Intronic
1065372623 10:25004287-25004309 ATATCCAGTTATGGGATTGCTGG + Intronic
1065525400 10:26615191-26615213 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1065839079 10:29685433-29685455 ATAGCCAGTAATGGGATTGCTGG + Intronic
1066156377 10:32682510-32682532 ATTCCCAGTAACGGGGTTGCTGG + Intronic
1066297006 10:34063167-34063189 GTACCCAGTAATGGGGTTGTTGG - Intergenic
1067250167 10:44579319-44579341 TATACCAGTAATGGGGTTGCTGG + Intergenic
1067314986 10:45152449-45152471 GTGGCCAGGTATGGTGGTGCAGG - Intergenic
1067331031 10:45319319-45319341 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1067430179 10:46237521-46237543 GGTGCCAGCTATGGGGTTCCAGG + Intergenic
1067675915 10:48376848-48376870 GTAACCAGTAATGGGATTGCTGG - Intronic
1068086607 10:52381401-52381423 GTACCCAGTAATGGGATTGCTGG + Intergenic
1068479203 10:57568099-57568121 ATAGCCAGTAATGGGATTGCGGG - Intergenic
1068511111 10:57967154-57967176 ATATCCAGTAATGGGGTTGCTGG - Intergenic
1069130677 10:64698236-64698258 ATAGCCAGTAGTGGGGTTGCTGG - Intergenic
1069349614 10:67509701-67509723 ATACCCAGTAATGGGGTTGCTGG + Intronic
1070858009 10:79623672-79623694 GTACCCAGTAATGGGATTGCTGG - Intergenic
1071000216 10:80823281-80823303 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1071090134 10:81908908-81908930 GTTGAGAGTGATGGGGTTGGTGG + Intronic
1071265377 10:83960188-83960210 CTTGCCACTTATGGGATTGAAGG + Intergenic
1071418941 10:85469696-85469718 ATTTCCAGTAATGGGATTGCTGG - Intergenic
1072076383 10:91978340-91978362 ATTGCCAGTGTTGGGGTTGAGGG + Intronic
1072402383 10:95118207-95118229 GTGCCCAGTAATGGGATTGCTGG + Intergenic
1072407280 10:95167424-95167446 ATGCCCAGTAATGGGGTTGCTGG - Intergenic
1073510353 10:104038888-104038910 GTTACGAGTTATTGGGTTGAGGG - Intronic
1073673845 10:105622781-105622803 GTACCCAGTAATGGGATTGCTGG - Intergenic
1073690259 10:105800143-105800165 GGGGCCTGTTGTGGGGTTGCGGG + Intergenic
1073784264 10:106871369-106871391 ATTCCCAGTAATGGGATTGCTGG - Intronic
1073846086 10:107556357-107556379 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1074365331 10:112853254-112853276 GTGGGCAGTTCTGGGGTTGGAGG - Intergenic
1074717876 10:116236297-116236319 GTTTCCAGTTCTGTGGTTCCTGG - Intronic
1074775383 10:116764226-116764248 ATTCCTAGATATGGGGTTGCTGG - Intergenic
1076005994 10:126948624-126948646 GTTTCCCGATGTGGGGTTGCAGG + Intronic
1076838149 10:133031691-133031713 CTGTCCAGTTATGGGGATGCTGG - Intergenic
1077831468 11:5876404-5876426 GTACCCAGTAATGGGATTGCTGG - Intronic
1077951805 11:6967316-6967338 GTACCCAGTAATGGGATTGCTGG + Intronic
1079437337 11:20470753-20470775 GTACCCAGTAATGGGATTGCTGG + Intronic
1079610583 11:22428276-22428298 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1079803796 11:24903986-24904008 ATATCCAGTAATGGGGTTGCTGG + Intronic
1079810375 11:24991579-24991601 GTAGCCAGTAATGGAATTGCTGG + Intronic
1081094012 11:38909256-38909278 ATTGCCAGTAGTGGGATTGCTGG - Intergenic
1081173156 11:39893227-39893249 GGGGCCTGTTGTGGGGTTGCGGG + Intergenic
1081398676 11:42617428-42617450 GTACCCAGTAATGGGATTGCTGG + Intergenic
1081416736 11:42824334-42824356 GTTGCCAGTCATTGAGTTACAGG + Intergenic
1081424908 11:42915527-42915549 GTACCCAGTAATGGGATTGCTGG + Intergenic
1081962451 11:47148362-47148384 GGTGTCAGTCATGGGGTGGCTGG - Intronic
1082131897 11:48500598-48500620 ATAACCAGTAATGGGGTTGCTGG - Intergenic
1082216300 11:49573894-49573916 ATAGCCAGTAATGGGATTGCAGG + Intergenic
1082565364 11:54671207-54671229 ATAACCAGTAATGGGGTTGCTGG - Intergenic
1082569180 11:54716909-54716931 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1083009049 11:59377000-59377022 GTAACCAGTGATGGGATTGCTGG - Intergenic
1084282088 11:68103964-68103986 ATTACCAGTAATGGGATTGCTGG - Intronic
1084562878 11:69914106-69914128 GTTGCCAGGGAGGGGGTTGTGGG + Intergenic
1084984104 11:72852352-72852374 GTGTCCAGTAATGGGATTGCTGG - Intronic
1085398657 11:76221370-76221392 GTAACCAGTAATGGGATTGCTGG - Intergenic
1085644095 11:78211463-78211485 ATAGCCAGTAATGGGATTGCTGG + Intronic
1086260293 11:84931621-84931643 ATAGCCAGTAATGGGATTGCTGG + Intronic
1086308824 11:85512821-85512843 ATTACCAGTAATGGGATTGCTGG - Intronic
1086633283 11:89050598-89050620 ATAGCCAGTAATGGGATTGCAGG - Intronic
1086816661 11:91380569-91380591 GTACCCAGTAATGGGATTGCTGG + Intergenic
1087107841 11:94429313-94429335 ATAGCCAGTAATGGGATTGCTGG - Intronic
1087550783 11:99645380-99645402 GTACCCAGTAATGGGATTGCTGG + Intronic
1087699960 11:101424945-101424967 GTACCCAGTAATGGGATTGCTGG + Intergenic
1088146775 11:106690151-106690173 ATTCCCAGTAATGGGATTGCTGG - Intronic
1088167043 11:106951251-106951273 ATACCCAGTAATGGGGTTGCTGG + Intronic
1088307783 11:108428292-108428314 ATACCCAGTAATGGGGTTGCTGG - Intronic
1088534630 11:110847017-110847039 TTTCCCAGTAATGGGATTGCTGG - Intergenic
1089069072 11:115685024-115685046 ATATCCAGTAATGGGGTTGCTGG - Intergenic
1090385710 11:126356489-126356511 GTTGGCAGTTCTGGGCTGGCCGG - Intronic
1090747413 11:129718140-129718162 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1090817005 11:130307018-130307040 GTTGATAGTTTTGGGGGTGCAGG - Intronic
1090877085 11:130800125-130800147 ATTCCCAGTAATGGGATTGCTGG + Intergenic
1090994581 11:131853752-131853774 ATAGCCAGTAATGGGATTGCTGG + Intronic
1092035940 12:5334465-5334487 ATTCCCAGTAATGGGATTGCTGG + Intergenic
1092691377 12:11114136-11114158 GTACCCAGTAATGGGATTGCTGG - Intronic
1092889874 12:12959351-12959373 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1093753215 12:22825063-22825085 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1094279205 12:28716674-28716696 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1095224302 12:39661166-39661188 ATAGCCAGTAATGAGGTTGCTGG + Intronic
1095513847 12:42984266-42984288 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1095660357 12:44725484-44725506 GTACCCAGTAATGGGATTGCTGG - Intronic
1095681410 12:44980891-44980913 ATTCCCAGTAATGGGATTGCAGG + Intergenic
1096892168 12:54782715-54782737 GGGGCCTGTCATGGGGTTGCGGG + Intergenic
1096956533 12:55531498-55531520 GTACCCAGTAATGGGATTGCAGG - Intergenic
1097520743 12:60667352-60667374 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1097524032 12:60707743-60707765 GTACCCAGTAATGGGATTGCTGG + Intergenic
1097620072 12:61928646-61928668 GTACCCAGTAATGGGATTGCTGG - Intronic
1097989358 12:65818879-65818901 GAAGCCAGGTATGGGGTAGCTGG + Intergenic
1098533591 12:71569789-71569811 ATACCCAGTTATGGGATTGCTGG - Intronic
1098852981 12:75619694-75619716 GTACCCAGTAATGGGATTGCTGG - Intergenic
1098858973 12:75686335-75686357 GTGCCCAGTAATGGGATTGCTGG - Intergenic
1099501635 12:83420514-83420536 GGTGCCTGTTGTGGGGTTGGGGG - Intergenic
1099514250 12:83576890-83576912 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1099562415 12:84194485-84194507 GTTTCCAGTAATGGAATTGCTGG - Intergenic
1099830692 12:87838861-87838883 GTACCCAGTAATGGGATTGCTGG - Intergenic
1099948498 12:89272891-89272913 GTGCCCAGTAATGGGATTGCTGG + Intergenic
1100081819 12:90861637-90861659 ATGCCCAGTAATGGGGTTGCTGG + Intergenic
1100578094 12:95911846-95911868 GTACCCAGTAATGGGATTGCTGG - Intronic
1100941605 12:99728606-99728628 ATACCCAGTAATGGGGTTGCTGG - Intronic
1100968959 12:100046207-100046229 ATAGCCAGTAATGGGATTGCTGG - Intronic
1101280704 12:103252303-103252325 GTACCCAGTAATGGGATTGCTGG + Intronic
1101487439 12:105179493-105179515 GTACCCAGTAATGGGATTGCTGG + Intronic
1102499293 12:113340370-113340392 GGTGCCAGTGCTGGGGTTCCAGG + Intronic
1102534683 12:113572089-113572111 ATTCCCAGTAATGGGATTGCTGG + Intergenic
1102537926 12:113595325-113595347 ATTCCCAGTAATGGGATTGCTGG + Intergenic
1102655822 12:114481405-114481427 GTGGCCAGTTATGGGGGGGAAGG + Intergenic
1102679118 12:114678704-114678726 GTTAGCAGTTATGGGGTGGGAGG - Intronic
1102767428 12:115445713-115445735 GCTGCCGGATCTGGGGTTGCAGG - Intergenic
1103428224 12:120857455-120857477 GTACCCAGTAATGGGATTGCTGG - Intronic
1104103317 12:125635651-125635673 GTACCCAGTAATGGGATTGCTGG + Intronic
1104321732 12:127757934-127757956 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1105655272 13:22429782-22429804 GTGCCCAGTAATGGGATTGCTGG + Intergenic
1107155188 13:37157913-37157935 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1107512214 13:41096053-41096075 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1108854099 13:54772231-54772253 GTACCCAGTAATGGGATTGCTGG + Intergenic
1109039788 13:57317517-57317539 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1109057483 13:57570027-57570049 ATTCCCAGTAATGGGATTGCTGG + Intergenic
1109139506 13:58696601-58696623 ATATCCAGTAATGGGGTTGCTGG - Intergenic
1109155984 13:58910159-58910181 GGTGCCAGTAATGGGGTAGGGGG + Intergenic
1109369158 13:61398600-61398622 GTATCCAGTAATGGGATTGCTGG + Intergenic
1109626949 13:64986709-64986731 GTAGCCAGTAATGGGATTGCTGG + Intergenic
1109635046 13:65104424-65104446 ATACCCAGTTATGGGATTGCTGG + Intergenic
1110115910 13:71816395-71816417 ATTCCCAGTAATGGGATTGCTGG - Intronic
1110674817 13:78229295-78229317 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1110755859 13:79172813-79172835 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1111043564 13:82784154-82784176 ATTCCCAGTAATGGGATTGCTGG + Intergenic
1111103456 13:83615116-83615138 GTTTCCAGTAATGGGATGGCTGG - Intergenic
1111177705 13:84618514-84618536 GTGCCCAGTAATGGGATTGCTGG + Intergenic
1112064877 13:95782313-95782335 GTACCCAGTAATGGGATTGCTGG + Intronic
1112077506 13:95929795-95929817 GTACCCAGTAATGGGATTGCTGG + Intronic
1112084127 13:96010117-96010139 ATACCCAGTTATGGGATTGCTGG - Intronic
1112242030 13:97691957-97691979 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1114149909 14:20026447-20026469 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1114352129 14:21864317-21864339 GTAGCCAGTAGTGGGATTGCTGG + Intergenic
1114358134 14:21937621-21937643 ATAGCCAGGTATGGGATTGCTGG + Intergenic
1114603567 14:23976585-23976607 ATATCCAGTAATGGGGTTGCTGG - Intronic
1114608579 14:24019359-24019381 ATATCCAGTAATGGGGTTGCTGG - Intergenic
1114880455 14:26778407-26778429 ATACCCAGTTATGGGATTGCTGG + Intergenic
1115792190 14:36892700-36892722 GGGGCCAGTTGTGGGGTTGGGGG - Intronic
1115896659 14:38096060-38096082 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1116092102 14:40322169-40322191 GTACCCAGTAATGGGATTGCTGG - Intergenic
1116247525 14:42435095-42435117 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1116348479 14:43827923-43827945 GTATCCAGTAATGGGATTGCTGG + Intergenic
1116544615 14:46149091-46149113 GTACCCAGTAATGGGATTGCTGG + Intergenic
1116553045 14:46266920-46266942 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1116660034 14:47698529-47698551 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1116751436 14:48890423-48890445 GCTGCCAGTTTTGTGGATGCTGG + Intergenic
1117187298 14:53253257-53253279 ATAGCCAGTGATGGGATTGCTGG + Intergenic
1117490552 14:56242481-56242503 ATGCCCAGTAATGGGGTTGCTGG - Intronic
1117855214 14:60024155-60024177 ATACCCAGTAATGGGGTTGCTGG + Intronic
1119345454 14:73919798-73919820 ATAGCCAGTAATGGGATTGCTGG + Intronic
1119930067 14:78537116-78537138 ATACCCAGTTATGGGATTGCTGG + Intronic
1120059262 14:79962597-79962619 GTTGCCAGGGTTAGGGTTGCAGG - Intergenic
1120276295 14:82377575-82377597 ATTTCCAGTAATGGGATTGCTGG - Intergenic
1121226748 14:92326880-92326902 GTTGCCTGTTGTAGGGTTGTTGG + Intronic
1121477811 14:94228347-94228369 GTTGCCAGTTATTAGCTTGCTGG + Intronic
1122083198 14:99281161-99281183 GCTGCCTGTTATTGGCTTGCAGG - Intergenic
1122100010 14:99400698-99400720 ATTTACAGTTATGGGCTTGCGGG - Intronic
1124681524 15:31735691-31735713 ATACCCAGTAATGGGGTTGCTGG - Intronic
1124865806 15:33489715-33489737 GTACCCAGTAATGGGATTGCTGG + Intronic
1125419712 15:39492516-39492538 GTTGCCAGTAATGATGTTTCTGG + Intergenic
1126201072 15:45986902-45986924 GTATCCAGTAATGGGATTGCTGG - Intergenic
1126928812 15:53623656-53623678 TTTCCCAGTAATGGGATTGCTGG + Intronic
1128537422 15:68501492-68501514 GTTCCCAGAGATGGGGTTGGTGG + Intergenic
1128649707 15:69401540-69401562 GTAGCAAGTTTTGGGGTTGCAGG + Intronic
1129563733 15:76598432-76598454 GTACCCAGTGATGGGATTGCTGG - Intronic
1130283202 15:82534853-82534875 GGGGCCTGTCATGGGGTTGCAGG + Intergenic
1130442422 15:83968643-83968665 ATACCCAGTTATGGGATTGCTGG - Intronic
1130728205 15:86462948-86462970 GTACCCAGTAATGGGATTGCTGG + Intronic
1131449421 15:92527058-92527080 GTAGCCAGTAATGGGATTGCTGG + Intergenic
1131589816 15:93736529-93736551 GTTCCCAGTAATGGGATTGCTGG + Intergenic
1131658112 15:94483334-94483356 ATACCCAGTTATGGGATTGCTGG - Exonic
1132015682 15:98314398-98314420 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1132103978 15:99049708-99049730 GATGCCAGTTACGGAGATGCGGG - Intergenic
1132323656 15:100947102-100947124 TTAGCCAGTTATGGTGGTGCGGG - Intronic
1133339465 16:5027294-5027316 GTTGCCAGTCTTGGGGTCACAGG + Exonic
1133722639 16:8509137-8509159 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1133815034 16:9190577-9190599 GTACCCAGTAATGGGATTGCTGG + Intergenic
1133901931 16:9983917-9983939 TTACCCAGTAATGGGGTTGCTGG + Intronic
1134875564 16:17695408-17695430 GTTGCCATATATGGTTTTGCAGG - Intergenic
1135843407 16:25896622-25896644 GTGCCCAGTAATGGGATTGCTGG - Intronic
1135897823 16:26424868-26424890 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1136601414 16:31292774-31292796 ATCCCCAGTAATGGGGTTGCTGG + Intronic
1137020238 16:35417991-35418013 ATACCCAGTAATGGGGTTGCAGG - Intergenic
1137374241 16:47939029-47939051 ATAGCCAGTAATGGGATTGCAGG - Intergenic
1137412385 16:48240155-48240177 GTACCCAGTAATGGGATTGCTGG - Intronic
1137510790 16:49098290-49098312 GTACCCAGTAATGGGGTTGCTGG - Intergenic
1137610028 16:49811822-49811844 GTTCCCAGATCTGGGGTTCCAGG - Intronic
1137980998 16:53069433-53069455 GTTGCCAGGGATGGGGTTAAGGG - Intronic
1138637253 16:58350681-58350703 ATTCCCAGTAATGGGATTGCTGG - Intronic
1138917353 16:61482688-61482710 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1140301512 16:73762458-73762480 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1140869913 16:79096758-79096780 GTTCCTAGTGATGGGGATGCAGG - Intronic
1142917976 17:3159000-3159022 GTACCCAGTAATGAGGTTGCTGG - Intergenic
1143059685 17:4189555-4189577 CTTGCCAGTCATAGGGTGGCAGG - Intronic
1143823767 17:9587379-9587401 GTAGCCAGTAATGGGATTGCTGG + Intronic
1144224326 17:13130346-13130368 GTACCCAGTAATGGGATTGCTGG - Intergenic
1144349219 17:14378629-14378651 TTTGCCAGGTATGGTGGTGCAGG - Intergenic
1144746125 17:17615907-17615929 GTACCCAGTAATGGGGTTGCTGG + Intergenic
1145192783 17:20860571-20860593 ATACCCAGTAATGGGGTTGCTGG - Intronic
1146874722 17:36399516-36399538 ATAGCCAGTAATGGGATTGCTGG + Intronic
1147064661 17:37913365-37913387 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1147851065 17:43443367-43443389 GCTGCCAGGTATGGGTGTGCAGG + Intergenic
1148780901 17:50121211-50121233 GTTGCATGTTTTGGGGTGGCAGG - Intronic
1149455450 17:56784339-56784361 GTACCCAGTAATGGGATTGCTGG + Intergenic
1149510706 17:57238978-57239000 GTTACCAGTAGTGGGATTGCTGG - Intergenic
1150057108 17:62028032-62028054 ATAACCAGTAATGGGGTTGCTGG - Intronic
1151007620 17:70456048-70456070 GTAGCCAGTAATGGAATTGCTGG + Intergenic
1151146226 17:72044016-72044038 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1152355382 17:79804299-79804321 GTTGCCGGTTCCGGGGCTGCCGG + Intergenic
1153697026 18:7653827-7653849 ATACCCAGTAATGGGGTTGCTGG + Intronic
1153785851 18:8534713-8534735 GTACCCAGTAATGGGATTGCTGG - Intergenic
1153829297 18:8906903-8906925 ATACCCAGTTGTGGGGTTGCTGG - Intergenic
1155549247 18:26947878-26947900 ATATCCAGTAATGGGGTTGCTGG - Intronic
1155893836 18:31298679-31298701 GGGGCCAGTCATGGGGTTGGGGG + Intergenic
1156116619 18:33793835-33793857 GGTGCCTGTTGTGGGGTTGGGGG + Intergenic
1157057761 18:44250774-44250796 GTACCCAGTCATGGGATTGCAGG + Intergenic
1157176246 18:45455126-45455148 ATACCCAGTTATGGGATTGCTGG - Intronic
1157542730 18:48523505-48523527 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1159281581 18:66292625-66292647 GTACCCAGTAATGGGATTGCTGG + Intergenic
1159339975 18:67122089-67122111 GCAACCAGTAATGGGGTTGCAGG - Intergenic
1159662907 18:71121215-71121237 ATTCCCAGTAATGGGATTGCTGG + Intergenic
1160369431 18:78359598-78359620 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1161173727 19:2827237-2827259 CTTGCAAGTTATGGGACTGCAGG - Intronic
1161357257 19:3826025-3826047 GCTGCCCGTTGTGGGGTTGGGGG - Intronic
1163976390 19:20857111-20857133 ATACCCAGTAATGGGGTTGCTGG - Intronic
1163995492 19:21042320-21042342 ATACCCAGTAATGGGGTTGCTGG + Intronic
1164151872 19:22560863-22560885 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1164267921 19:23638884-23638906 GTACCCAGTTATGGAATTGCTGG - Intronic
1164440912 19:28279275-28279297 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1164917393 19:32062842-32062864 ATACCCAGTTATGGGATTGCTGG + Intergenic
1165978932 19:39703248-39703270 ATTCCCAGTAATGGGATTGCGGG - Intergenic
1166246748 19:41533500-41533522 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1166409207 19:42545227-42545249 ATACCCAGTAATGGGGTTGCAGG + Intronic
1166632731 19:44421389-44421411 GTACCCAGTAATGGGATTGCTGG + Intronic
1167607668 19:50490068-50490090 GTTTTCAGTTATGGGGTTGGGGG - Exonic
1168010221 19:53524273-53524295 ATACCCAGTTATGGGATTGCTGG + Intronic
925360805 2:3278789-3278811 GTTGCCAGTTATGGGGTTGCTGG - Intronic
926477773 2:13348850-13348872 GTGCCCAGTAATGGGATTGCTGG + Intergenic
926776770 2:16430893-16430915 GTTGCCAGTGATGTGGGTGGTGG - Intergenic
927265993 2:21151602-21151624 GTGCCCAGTAATGGGATTGCTGG + Intergenic
927300219 2:21503557-21503579 ATACCCAGTTATGGGATTGCTGG + Intergenic
927330588 2:21858557-21858579 ATACCCAGTTGTGGGGTTGCTGG - Intergenic
928252730 2:29696015-29696037 GTACCCAGTAATGGGATTGCTGG - Intronic
928425125 2:31171452-31171474 GTTGCCAGCTAGGGGTTTTCGGG - Intergenic
928533432 2:32216069-32216091 ATACCCAGTTATGGGATTGCTGG + Intronic
928822506 2:35378576-35378598 CCTGCCAGTTTTGGGGCTGCTGG - Intergenic
928943655 2:36752838-36752860 GTACCCAGTAATGGGATTGCTGG - Intronic
928953187 2:36833237-36833259 GTACCCAGTAATGGGATTGCTGG + Intergenic
929248494 2:39728072-39728094 GTACCCAGTAATGGGATTGCTGG + Intergenic
929351945 2:40966986-40967008 GTACCCAGTAATGGGATTGCTGG - Intergenic
930542809 2:52728582-52728604 TTTCCCAGTAATGGGATTGCTGG + Intergenic
930624387 2:53680254-53680276 ATACCCAGTTATGGGATTGCTGG + Intronic
930806524 2:55496053-55496075 GGTGCCAATAATGGGATTGCTGG + Intergenic
930914421 2:56669911-56669933 ATACCCAGTAATGGGGTTGCTGG + Intergenic
930936480 2:56958756-56958778 ATTGCCAGTAATGGGATTGCTGG + Intergenic
931480931 2:62639193-62639215 GTACCCAGTAATGGGATTGCTGG - Intergenic
931577958 2:63739537-63739559 GTACCCAGTAATGGGATTGCTGG + Intronic
931596060 2:63945018-63945040 GTAACCAGTAATGGGATTGCTGG - Intronic
932045901 2:68349592-68349614 ATTCCCAGTAATGGGATTGCTGG - Intergenic
932686880 2:73878353-73878375 ATAGCCAGTAATGGGATTGCTGG + Intergenic
933047988 2:77563281-77563303 ATTCCCAGTAATGGGATTGCTGG - Intronic
933358116 2:81240799-81240821 GTGGCCAGTGGTGGGGTTGGGGG - Intergenic
933398345 2:81760398-81760420 ATTCCCAGTAATGGGATTGCTGG - Intergenic
933900026 2:86842955-86842977 GATGCCAGTTTTGGGGAGGCTGG - Intronic
933911943 2:86948819-86948841 GTCGCCAGTGCTGGGATTGCAGG + Intronic
934011052 2:87821075-87821097 GTCGCCAGTGCTGGGATTGCAGG - Intronic
934142715 2:89063530-89063552 GTACCCAGTAATGGGATTGCTGG + Intergenic
934226532 2:90137024-90137046 GTACCCAGTAATGGGATTGCTGG - Intergenic
934551152 2:95262681-95262703 GTTGACATTTATGGTGCTGCCGG + Intergenic
935569679 2:104645926-104645948 GTGGCCTGTTGTGGGGTTGGGGG + Intergenic
935651723 2:105387736-105387758 ATTCCCAGTAATGGGATTGCTGG - Intronic
935774614 2:106461790-106461812 GTTGCCAGTGCTGGGATTGCAGG - Intronic
935780532 2:106506270-106506292 GATGCCAGTTTTGGGGAGGCTGG + Intergenic
935905453 2:107834127-107834149 GTTGCCAGAGCTGGGATTGCAGG + Intronic
935991818 2:108725849-108725871 GTCGCCAGTGCTGGGATTGCAGG + Intronic
936127244 2:109799365-109799387 GTCGCCAGTGCTGGGATTGCAGG + Intronic
936217453 2:110572120-110572142 GTCGCCAGTGCTGGGATTGCAGG - Intronic
936426595 2:112426697-112426719 GTCGCCAGTGCTGGGATTGCAGG - Intronic
936804383 2:116310130-116310152 ATACCCAGTTATGGGATTGCTGG + Intergenic
937168171 2:119840598-119840620 GTACCCAGTAATGGGATTGCTGG + Intronic
937521524 2:122718597-122718619 ATTTCCAGTAATGGGATTGCTGG - Intergenic
937545339 2:123010722-123010744 GTAGCCAGTAGTGGGATTGCTGG - Intergenic
937893445 2:126958125-126958147 ATAGCCAGTAATGGGATTGCTGG + Intergenic
938549333 2:132365974-132365996 ATACCCAGTAATGGGGTTGCTGG - Intergenic
938690607 2:133785712-133785734 GTACCCAGTAATGGGATTGCTGG - Intergenic
939093284 2:137803465-137803487 ATAACCAGTTATGGGATTGCTGG - Intergenic
939107060 2:137961638-137961660 GTACCCAGTAATGGGATTGCTGG - Intergenic
939147162 2:138429551-138429573 GTTGTCAGTTATTGGGCTGTTGG - Intergenic
939328344 2:140724828-140724850 GTTGGTAGTTGTGGGGTGGCAGG - Intronic
939380172 2:141425071-141425093 GTGGCCTGTTGTGGGGTTGGGGG - Intronic
940366534 2:152854231-152854253 GTATCCAGTAATGGGATTGCTGG + Intergenic
940590134 2:155713188-155713210 GTCACCAGTTAAGGGGTTGTTGG - Intergenic
940703279 2:157073234-157073256 ATAGCCAGTAATGGGATTGCTGG - Intergenic
940705221 2:157097409-157097431 GGGGCCAGTCATGGGGTTGGGGG - Intergenic
940821891 2:158365287-158365309 GTACCCAGTAATGGGCTTGCTGG - Intronic
941057858 2:160808560-160808582 GTACCCAGTAATGGGATTGCTGG + Intergenic
941133977 2:161690425-161690447 GTAGCCAGTAATGGGATTGCTGG - Intronic
941418950 2:165258564-165258586 ATACCCAATTATGGGGTTGCTGG - Intronic
941592924 2:167442388-167442410 ATAGCCAGTAATGGGATTGCTGG + Intergenic
942288809 2:174449359-174449381 GTACCCAGTAATGGGATTGCTGG - Intronic
942391137 2:175494230-175494252 ATACCCAGTAATGGGGTTGCTGG + Intergenic
942632392 2:177964881-177964903 ATACCCAGTAATGGGGTTGCAGG + Intronic
942817965 2:180075072-180075094 GATCCCAGTAATGGGATTGCTGG - Intergenic
943177509 2:184496166-184496188 ATACCCAGTAATGGGGTTGCTGG - Intergenic
943256238 2:185596784-185596806 ATAGCCAGTAATGGGATTGCTGG - Intergenic
944167352 2:196737154-196737176 GTTTCCAGTAATGGGATTGCTGG + Intronic
944356660 2:198797884-198797906 ATAGCCAGTAATGGGATTGCTGG - Intergenic
945678799 2:212888083-212888105 ATAGCCAGTAATGGGATTGCTGG - Intergenic
946553595 2:220830167-220830189 ATACCCAGTTATGGGATTGCTGG - Intergenic
947086573 2:226459694-226459716 ATAGCCAGTAATGGGATTGCTGG - Intergenic
947266195 2:228284825-228284847 ATACCCAGTAATGGGGTTGCTGG + Intergenic
947485533 2:230545063-230545085 GTACCCAGTAATGGGATTGCTGG - Intergenic
947737870 2:232466611-232466633 GTACCCAGTAGTGGGGTTGCTGG + Intergenic
948910554 2:241000246-241000268 GTTGGCAGTTGTGGGGTGGGAGG - Intronic
949081824 2:242107014-242107036 ATACCCAGTAATGGGGTTGCTGG + Intergenic
949082271 2:242111991-242112013 GTTACCAGGTCTGGGGGTGCTGG - Intergenic
1169292228 20:4362426-4362448 TTTGCCAGTTATTGGGGGGCAGG - Intergenic
1169528748 20:6460374-6460396 ATACCCAGTCATGGGGTTGCTGG - Intergenic
1170717497 20:18844628-18844650 GGTGCCACGTATGGGGTTGGGGG - Intergenic
1171895285 20:30752634-30752656 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1173773981 20:45687521-45687543 ATACCCAGTAATGGGGTTGCTGG + Intronic
1175685671 20:61026557-61026579 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1176127385 20:63482099-63482121 GCTGCCAGCTGTGGGGTTCCAGG - Intergenic
1176975902 21:15321555-15321577 GTAACCAGTAATGGGATTGCTGG + Intergenic
1177350881 21:19939675-19939697 ATTGCCAGTTATAAGGTAGCTGG - Intergenic
1177715691 21:24837501-24837523 ATACCCAGTAATGGGGTTGCCGG + Intergenic
1177784111 21:25651601-25651623 GTTCCCAGTAACGGGGTTGATGG - Intronic
1177810267 21:25918159-25918181 ATTCCCAGTAATGGGATTGCTGG - Intronic
1177956006 21:27600249-27600271 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1178055035 21:28789018-28789040 GTTCCCTCTTAGGGGGTTGCAGG - Intergenic
1178795105 21:35736695-35736717 ATTCCCAGTAATGGGATTGCTGG - Intronic
1179434882 21:41354266-41354288 ATTCCCAGTAATGGGATTGCTGG - Intronic
1181302291 22:21889397-21889419 GCTGCCTGTCATGGGGTTGGGGG - Intergenic
1181865995 22:25855762-25855784 ATGCCCAGTAATGGGGTTGCTGG + Intronic
1181898633 22:26133442-26133464 GGGGCCTGTTATGGGGTTGGGGG + Intergenic
1185083359 22:48722049-48722071 ATACCCAGTTATGGGATTGCTGG + Intronic
949274161 3:2258224-2258246 ATAGCCAGTAATGGGATTGCTGG - Intronic
949298121 3:2550581-2550603 ATACCCAGTAATGGGGTTGCTGG - Intronic
949432705 3:3994856-3994878 ATTCCCAGTAATGGGATTGCTGG + Intronic
949434386 3:4012849-4012871 GTAGCCAGTAATTGGATTGCTGG - Intronic
949450518 3:4180175-4180197 GTACCCAGTAATGGGATTGCTGG - Intronic
949453828 3:4216995-4217017 ATTCCCAGTAATGGGATTGCTGG - Intronic
949580106 3:5379148-5379170 GTATCCAGTAATGGGATTGCTGG + Intergenic
951628563 3:24693630-24693652 ATACCCAGTTATGGGATTGCTGG + Intergenic
951759042 3:26124975-26124997 GTACCCAGTAATGGGATTGCTGG + Intergenic
951838415 3:27006726-27006748 ATAGCCAGTAATGGGATTGCTGG - Intergenic
951938087 3:28044870-28044892 ATATCCAGTAATGGGGTTGCTGG + Intergenic
952679021 3:36069550-36069572 ATACCCAGTTATGGGATTGCTGG + Intergenic
953122781 3:40061594-40061616 GTACCCAGTAATGGGATTGCTGG + Intronic
953667519 3:44936486-44936508 GTATCCAGTAATGGGATTGCTGG - Intronic
954628362 3:52035134-52035156 GTTCCCAGGAATGGGATTGCTGG + Intergenic
954702649 3:52458874-52458896 TTTGGCAGTTGTGGGTTTGCAGG - Intronic
954835297 3:53461528-53461550 ATTGCCAGTGATGGGGCTGTGGG + Intergenic
955272213 3:57512693-57512715 ATTCCCAGTAATGGGATTGCTGG - Intronic
955491840 3:59490675-59490697 GTACCCAGTAATGGGATTGCTGG + Intergenic
955946243 3:64197270-64197292 GTAACCAGTAATGGGATTGCTGG + Intronic
956356212 3:68395422-68395444 ATAGCCAGTAATGGGATTGCTGG - Intronic
957123329 3:76125356-76125378 TATGCCAGTCATGGGATTGCTGG + Intronic
957400097 3:79700384-79700406 GTACCCAGTAATGGGATTGCTGG + Intronic
957785287 3:84874604-84874626 ATACCCAGTTATGGGATTGCTGG + Intergenic
957843449 3:85699966-85699988 ATAGCCAGTAATGGGATTGCTGG - Intronic
957992126 3:87639536-87639558 ATAGCCAGTAATGGGATTGCTGG + Intergenic
958079104 3:88722631-88722653 GTACCCAGTAATGGGATTGCTGG - Intergenic
958087436 3:88828565-88828587 ATAGCCAGTAATGGGATTGCTGG + Intergenic
958665206 3:97128363-97128385 GGTACCAGTAATGGGATTGCTGG + Intronic
959306755 3:104677087-104677109 GTTCCCAATAATGGGATTGCTGG - Intergenic
959422444 3:106145690-106145712 GTACCCAGTAATGGGATTGCTGG + Intergenic
959610626 3:108290850-108290872 GTACCCAGTAATGGGATTGCTGG + Intergenic
959715241 3:109425586-109425608 GTAGCCAGTAATGGGGTTGCTGG + Intergenic
960051917 3:113247275-113247297 GTTCCCAGTTATGGGATTTTAGG - Intronic
960208981 3:114937127-114937149 ATAGCCAGTAATGGGATTGCTGG + Intronic
960711558 3:120535624-120535646 GTACCCAGTAATGGGATTGCTGG - Intergenic
961227840 3:125269588-125269610 GTACCCAGTAATGGGATTGCTGG - Intronic
961912850 3:130338334-130338356 ATTCCCAGTAATGGGATTGCTGG + Intergenic
961937164 3:130597518-130597540 AGTGCCAGCTATGGGGCTGCTGG - Intronic
963013435 3:140797731-140797753 GTACCCAGTAATGGGATTGCTGG + Intergenic
963638817 3:147833924-147833946 GTACCCAGTAATGGGATTGCTGG + Intergenic
963639274 3:147838487-147838509 ATGCCCAGTAATGGGGTTGCTGG + Intergenic
964000432 3:151764760-151764782 ATACCCAGTTATGGGATTGCTGG - Intergenic
964242973 3:154617320-154617342 ATTTCCAGTAATGGGATTGCTGG - Intergenic
965084593 3:164078648-164078670 GTACCCAGTAATGGGATTGCTGG - Intergenic
965280767 3:166749224-166749246 TATACCAGTTATGGGATTGCTGG + Intergenic
965548305 3:169937768-169937790 ATAGCCAGTAATGGGATTGCTGG + Intronic
965853060 3:173054265-173054287 ATACCCAGTAATGGGGTTGCTGG - Intronic
966057545 3:175714240-175714262 ATACCCAGTTATGGGATTGCTGG + Intronic
966263719 3:178012088-178012110 GTAACCAGTAATGGGATTGCTGG - Intergenic
966293362 3:178387013-178387035 ATTGTCAGTTCTGGGGTGGCAGG + Intergenic
966309917 3:178581992-178582014 ATACCCAGTAATGGGGTTGCTGG - Intronic
966574001 3:181478692-181478714 GTACCCAGTAATGGGATTGCTGG + Intergenic
966799489 3:183749443-183749465 GTTGCCAGTGCTGGGGGGGCGGG - Intronic
966948270 3:184793168-184793190 GATACCAGTAATGGGATTGCCGG + Intergenic
967750023 3:193102699-193102721 GTACCCAGTAATGGGATTGCAGG + Intergenic
968354383 3:198092722-198092744 ATATCCAGTAATGGGGTTGCTGG + Intergenic
968822722 4:2867862-2867884 GCAGCCAGTAATGGGGTTGCTGG - Intronic
969383043 4:6819731-6819753 GTAGCTAGTAATGGGATTGCTGG - Intronic
969763174 4:9205981-9206003 ATAGCCAGTAATGGGATTGCTGG - Intergenic
969941483 4:10736425-10736447 TCTGCCAGTTATGGGGTTCCTGG + Intergenic
970109904 4:12626150-12626172 GTGCCCAGTAATGGGATTGCTGG + Intergenic
970685732 4:18565040-18565062 ATGCCCAGTTATGGGATTGCAGG - Intergenic
970687134 4:18581239-18581261 TTTCCCAGTAATGGGATTGCTGG + Intergenic
970966275 4:21931788-21931810 ATTCCCAGTAATGGGATTGCTGG + Intronic
971554419 4:27995335-27995357 GTACCCAGTAATGGGATTGCTGG + Intergenic
971856101 4:32045493-32045515 ATACCCAGTTATGGGATTGCTGG + Intergenic
971952616 4:33373703-33373725 ATACCCAGTAATGGGGTTGCTGG - Intergenic
971976460 4:33694999-33695021 ATAGCCAGTAATGGGATTGCTGG - Intergenic
972252546 4:37318989-37319011 GTACCCAGTCATGGGATTGCTGG + Intronic
972660942 4:41115946-41115968 ATACCCAGTAATGGGGTTGCTGG - Intronic
973308685 4:48682899-48682921 GTACCCAGTAATGGGATTGCTGG - Intronic
973747102 4:53974457-53974479 ATTCCCAGTAATGGGATTGCTGG + Intronic
974372624 4:61037414-61037436 ATACCCAGTTGTGGGGTTGCTGG + Intergenic
974643930 4:64669170-64669192 ATACCCAGTAATGGGGTTGCTGG - Intergenic
974749219 4:66114920-66114942 GGGGCCAGTTGTGGGGTTGGGGG + Intergenic
974884472 4:67801482-67801504 ATACCCAGTAATGGGGTTGCTGG - Intergenic
975166206 4:71180847-71180869 ATAGCCAGTAATGGGATTGCTGG - Intergenic
975413325 4:74080380-74080402 ATACCCAGTAATGGGGTTGCTGG - Intergenic
975453959 4:74566941-74566963 GTATCCAGTAATGGGATTGCTGG - Intergenic
975592932 4:76018077-76018099 ATACCCAGTTATGGGATTGCTGG - Intronic
976511590 4:85915930-85915952 ATACCCAGTAATGGGGTTGCTGG + Intronic
976681740 4:87764821-87764843 GTGCCCAGTAATGGGATTGCTGG - Intergenic
976926436 4:90503564-90503586 GGGGCCTGTTATGGGGTTGAGGG - Intronic
977180176 4:93864610-93864632 ATTCCCAGTAGTGGGGTTGCTGG - Intergenic
977520137 4:98072039-98072061 GTACCCAGTAATGGGATTGCTGG - Intronic
977819383 4:101454369-101454391 ATAGCCAGTAATGGGATTGCTGG + Intronic
978025123 4:103863973-103863995 ATGCCCAGTAATGGGGTTGCTGG + Intergenic
978090807 4:104712430-104712452 ATTCCCAGTAATGGGATTGCTGG - Intergenic
978360251 4:107923984-107924006 GATGCCATTTATGGGGGAGCAGG + Intergenic
978419712 4:108517874-108517896 GTACCCAGTAATGGGATTGCTGG - Intergenic
978642927 4:110892746-110892768 GTACCCAGTAATGGGATTGCTGG - Intergenic
978820769 4:112962554-112962576 GTACCCAGTAATGGGATTGCTGG + Intronic
978833482 4:113117468-113117490 GTTGCCAGTTCTGAGGCTGATGG - Intronic
978998986 4:115194273-115194295 ATAGCCAGTAATGGGATTGCTGG + Intergenic
979068029 4:116164307-116164329 ATAGCCAGTAATGGGATTGCTGG + Intergenic
979853725 4:125606030-125606052 GTATCCAGTAATGGGATTGCTGG + Intergenic
980578465 4:134716074-134716096 GTACCCAGTAATGGGATTGCTGG - Intergenic
980741521 4:136955949-136955971 GTACCCAGTAATGGGATTGCTGG - Intergenic
980848460 4:138352844-138352866 ATAGCCAGTAATGGGATTGCTGG - Intergenic
981919793 4:150075186-150075208 ATACCCAGTAATGGGGTTGCTGG + Intergenic
982458424 4:155637474-155637496 GTTGCCAGTTTTGGGGAGGAAGG + Intergenic
982788932 4:159567824-159567846 ATACCCAGTAATGGGGTTGCTGG + Intergenic
983136932 4:164096046-164096068 GTACCCAGTAATGGGATTGCTGG - Intronic
983223404 4:165064396-165064418 GTTGCCAGGTGTGGTGGTGCAGG - Intergenic
983693001 4:170495511-170495533 GTACCCAGTGATGGGATTGCTGG - Intergenic
983727252 4:170943698-170943720 ATACCCAGTTATGGGATTGCTGG - Intergenic
983971891 4:173885600-173885622 ATACCCAGTTATGGGATTGCTGG + Intergenic
984023531 4:174516123-174516145 ATACCCAGTAATGGGGTTGCTGG - Intronic
984076285 4:175184791-175184813 GTATCCAGTGATGGGATTGCTGG + Intergenic
984202476 4:176742450-176742472 CATACCAGTAATGGGGTTGCTGG + Intronic
984404471 4:179309597-179309619 ATAGCCAGTAATGGGATTGCTGG + Intergenic
984457743 4:179992370-179992392 GTACCCAGTTGTGGGCTTGCTGG - Intergenic
984525654 4:180856383-180856405 ATAGCCAGTAATGGGATTGCTGG + Intergenic
985317929 4:188678335-188678357 ATTCCCAGTAATGGGGTTGCTGG - Intergenic
985375511 4:189333283-189333305 GTTCCCAGTAATGGGATTGCTGG - Intergenic
985619945 5:948938-948960 GGTGCCTGTTCTGGGGGTGCAGG - Intergenic
986272754 5:6248412-6248434 GTTGCCAGGTATTGGGGTGGGGG - Intergenic
986551693 5:8963120-8963142 ATAGCCAGTAATGGGATTGCTGG + Intergenic
987490279 5:18571666-18571688 ATTCCCAGTAATGGGATTGCTGG - Intergenic
987653506 5:20775558-20775580 GTACCCAGTAATGGGATTGCTGG + Intergenic
987907074 5:24090894-24090916 ATACCCAGTTATGGGATTGCTGG - Intronic
988058682 5:26136837-26136859 ATAGCCAGTAATGGGATTGCTGG - Intergenic
988072337 5:26308412-26308434 GGTGCCTGTTGTGGGGTTGGGGG + Intergenic
988089253 5:26514205-26514227 ATACCCAGTAATGGGGTTGCTGG + Intergenic
988172755 5:27681019-27681041 GTGCCCAGTAATGGGATTGCTGG - Intergenic
988420973 5:31005760-31005782 GTACCCAGTAATGGGATTGCTGG + Intergenic
988742068 5:34085920-34085942 GTACCCAGTAATGGGATTGCTGG - Intronic
989696088 5:44202248-44202270 GTGCCCAGTAATGGGATTGCTGG + Intergenic
989696752 5:44210825-44210847 GTACCCAATAATGGGGTTGCTGG + Intergenic
990223794 5:53626390-53626412 GTACCCAGTAATGGGATTGCTGG + Intronic
990745347 5:58953587-58953609 ATACCCAGTTATGGGATTGCTGG + Intergenic
992054738 5:72977135-72977157 ATAGCCAGTAATGGGATTGCTGG + Intronic
992163195 5:74022328-74022350 ATAGCCAGTAATGGGATTGCTGG + Intergenic
992757232 5:79919362-79919384 GTACCCAGTAATGGGATTGCTGG - Intergenic
992778723 5:80109701-80109723 GTTGCCAGGAATTGGGCTGCTGG - Intergenic
992871942 5:81015276-81015298 ATAGCCAGTAATGGGATTGCTGG + Intronic
993357818 5:86936860-86936882 GTACCCAGTAATGGGATTGCTGG + Intergenic
993517005 5:88850087-88850109 GGGGCCTGTTATGGGGTTGGGGG - Intronic
993604127 5:89966606-89966628 AAAGCCACTTATGGGGTTGCGGG - Intergenic
993871591 5:93260834-93260856 GGTGCCTGTCATGGGGTTGGGGG + Intergenic
994064305 5:95518820-95518842 GTTCCCAGTGGTGGGGTTGCTGG + Intronic
994070402 5:95595314-95595336 GTACCCAGTAATGGGATTGCTGG - Intronic
994381879 5:99080678-99080700 GTACCCAGTAATGGGATTGCTGG + Intergenic
994408156 5:99372066-99372088 GATACCAGTAATGGGATTGCTGG + Intergenic
994504787 5:100628881-100628903 GTATCCAGTAATGGGATTGCTGG + Intergenic
994652943 5:102552073-102552095 GTACCCAGTAATGGGATTGCTGG + Intergenic
994835654 5:104848997-104849019 ATAGCCAGTAATGGGATTGCTGG + Intergenic
994917540 5:105999568-105999590 ATAGCCAGTAATGGGATTGCTGG + Intergenic
994978161 5:106838222-106838244 ATAGCCAGTAATGGGATTGCTGG + Intergenic
995157519 5:108932531-108932553 ATAGCCAGTAATGGGATTGCTGG + Intronic
995162249 5:108995776-108995798 ATAGCCAGTAATGGGATTGCTGG + Intronic
995252061 5:110005176-110005198 GTACCCAGTAATGGGATTGCTGG + Intergenic
995262760 5:110124412-110124434 GTAGCCAATAATGGGATTGCTGG + Intergenic
995263373 5:110131436-110131458 GTACCCAGTAATGGGATTGCTGG + Intergenic
995348189 5:111144813-111144835 GTATCCAGTAATGGGATTGCTGG + Intergenic
995423666 5:111994695-111994717 ATAGCCAGTAATGGGATTGCTGG - Intronic
995464917 5:112441599-112441621 ATACCCAGTTATGGGATTGCTGG - Intergenic
995489337 5:112674002-112674024 GTACCCAGTAATGGGATTGCTGG + Intergenic
995621120 5:114026862-114026884 GTACCCAGTAATGGGATTGCTGG - Intergenic
996072072 5:119142667-119142689 ATAGCCAGTAATGGGATTGCTGG - Intronic
996864746 5:128107801-128107823 GTCCCCAGTAATGGGATTGCTGG + Intronic
997869059 5:137490744-137490766 GTTGCCAGTTTTGGGGGAGGAGG + Intronic
997876454 5:137552465-137552487 ATACCCAGTAATGGGGTTGCTGG - Intronic
997892721 5:137689312-137689334 ATACCCAGTAATGGGGTTGCTGG - Intronic
998655418 5:144173110-144173132 ATTCCCAGTAATGGGATTGCTGG - Intronic
998691069 5:144588951-144588973 ATACCCAGTAATGGGGTTGCTGG + Intergenic
998718280 5:144911178-144911200 TTACCCAGTAATGGGGTTGCTGG - Intergenic
998732005 5:145089232-145089254 ATAGCCAGTAATGGGGTTGCTGG - Intergenic
999323065 5:150626518-150626540 GGTGTCAGTTGTGGGGTTGAGGG - Intronic
999510040 5:152240624-152240646 ATTCCCAGTAATGGGATTGCTGG - Intergenic
999533059 5:152483870-152483892 ATTTCCAGTAATGGGATTGCTGG - Intergenic
1000276461 5:159740466-159740488 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1000523069 5:162320900-162320922 GTTGCCAGGGATGGGGTGGGAGG + Intergenic
1000654055 5:163854572-163854594 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1000708320 5:164538984-164539006 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1000800792 5:165723699-165723721 GTTCTCAGATATGGGGTTTCTGG + Intergenic
1001657848 5:173366574-173366596 ATTGCAAGTAATGGGATTGCTGG + Intergenic
1002896918 6:1384750-1384772 GTGGCGAGTTGCGGGGTTGCGGG - Intergenic
1003002681 6:2350680-2350702 ATACCCAGTCATGGGGTTGCTGG + Intergenic
1003750879 6:9054422-9054444 GTACCCAGTAATGGGATTGCTGG + Intergenic
1004034112 6:11905290-11905312 ATAGCCAGTTATGAGATTGCTGG + Intergenic
1004497317 6:16176613-16176635 ATACCCAGTTATGGGATTGCTGG - Intergenic
1004743976 6:18491647-18491669 GTGGGCAGTTATGGCTTTGCAGG + Intergenic
1005182380 6:23120486-23120508 ATTCCCAGTAATGGGATTGCTGG + Intergenic
1006265294 6:32916623-32916645 GTTCCCAGTAATGGGATTGCTGG + Intergenic
1007121151 6:39382678-39382700 ATAGCCAGTAATGGGATTGCTGG + Intronic
1008189461 6:48436954-48436976 GTACCCAGTAATGGGATTGCTGG + Intergenic
1008423573 6:51331110-51331132 GTTGCCAGTGAGGAGGTTGTGGG - Intergenic
1008424717 6:51343791-51343813 GTACCCAGTAATGGGATTGCTGG + Intergenic
1008819497 6:55613425-55613447 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1008963111 6:57287239-57287261 GTACCCAGTAATGGGATTGCTGG - Intergenic
1009044844 6:58226014-58226036 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1009220659 6:60980332-60980354 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1009237008 6:61135475-61135497 GGGGCCTGTTATGGGGTTGGGGG - Intergenic
1009376592 6:62978563-62978585 GTACCCAGTAATGGGATTGCTGG + Intergenic
1009492521 6:64310214-64310236 GTACCCAGTGATGGGATTGCTGG - Intronic
1009495468 6:64341184-64341206 ATGGCCAGTAATGGGATTGCTGG - Intronic
1010066601 6:71689123-71689145 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1010819830 6:80400694-80400716 GTACCCAGTTATAGGATTGCTGG - Intergenic
1010820863 6:80413810-80413832 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1011185279 6:84668527-84668549 GTAACCAGTAATGGGATTGCTGG - Intergenic
1011209674 6:84941609-84941631 GTACCCAGTAATGGGATTGCTGG - Intergenic
1011388133 6:86819928-86819950 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1012063557 6:94517186-94517208 ATACCCAGTTATGGGATTGCTGG - Intergenic
1012284912 6:97377048-97377070 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1012410991 6:98956932-98956954 GTACCCAGTAATGGGATTGCTGG - Intergenic
1012596626 6:101048693-101048715 GTATCCAGTAATGGGATTGCTGG + Intergenic
1012688757 6:102287328-102287350 ATTTCCAGTAATGGGATTGCTGG - Intergenic
1014466645 6:121764050-121764072 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1014578798 6:123108618-123108640 ATATCCAGTAATGGGGTTGCTGG + Intergenic
1015093531 6:129387536-129387558 ATACCCAGTTATGGGGTTGCTGG - Intronic
1015192902 6:130491026-130491048 ATAGCCAGTAATGGGATTGCGGG + Intergenic
1015322308 6:131889800-131889822 GTACCCAGTAATGGGATTGCTGG + Intronic
1015493868 6:133859576-133859598 GTACCCAGTAATGGGATTGCTGG + Intergenic
1016105409 6:140156706-140156728 GTGCCCAGTAATGGGATTGCTGG - Intergenic
1016324121 6:142880296-142880318 GGTGCAAGTTATGGGGTTGTTGG - Intronic
1016362295 6:143280352-143280374 GTACCCAGTGATGGGATTGCTGG - Intronic
1016417876 6:143852083-143852105 GTACCCAGTAATGGGATTGCTGG + Intronic
1016629144 6:146207170-146207192 ATACCCAGTAATGGGGTTGCTGG + Intronic
1017090914 6:150758190-150758212 ATAGCCAGTAATGGGATTGCTGG + Intronic
1017208968 6:151834179-151834201 ATAGCCAGTAATGGGATTGCTGG - Intronic
1017231054 6:152074252-152074274 GTTGCCAGGAATGGGGTGGAGGG - Intronic
1017271634 6:152514109-152514131 ATACCCAGTAATGGGGTTGCTGG - Intronic
1017361666 6:153579640-153579662 GTACCCAGTAATGGTGTTGCAGG - Intergenic
1020361743 7:7334114-7334136 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1020755758 7:12201275-12201297 GGTGACAGTTATAGGGTTGTGGG - Intergenic
1021834802 7:24659359-24659381 GTACCCAGTAATGGGATTGCTGG + Intronic
1022083675 7:27046216-27046238 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1022570188 7:31445106-31445128 GTTGCCACTTATAGGATTGGAGG - Intergenic
1022782080 7:33596010-33596032 GGGGCCAGTCATGGGGTTGGAGG + Intronic
1022966900 7:35482492-35482514 GTTCCCAGCTATGAGGCTGCAGG + Intergenic
1023035196 7:36125621-36125643 GTATCCAGTAATGGGATTGCTGG - Intergenic
1023167287 7:37355343-37355365 TTTGCCAGACATGGGGTAGCTGG + Intronic
1023171851 7:37397631-37397653 ATACCCAGTAATGGGGTTGCTGG - Intronic
1023234757 7:38073181-38073203 ATACCCAGTTATGGGATTGCTGG + Intergenic
1023256869 7:38321054-38321076 ATATCCAGTTATGGGATTGCTGG + Intergenic
1024442547 7:49437310-49437332 GTACCCAGTAATGGGATTGCTGG - Intergenic
1024815208 7:53261091-53261113 ATTGCCAGTAGTGGGATTGCTGG - Intergenic
1024897090 7:54272715-54272737 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1025038384 7:55617869-55617891 ATACCCAGTTATGGGATTGCTGG - Intergenic
1025109357 7:56200504-56200526 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1025121642 7:56309064-56309086 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1025266063 7:57458165-57458187 ATTCCCAATTGTGGGGTTGCCGG + Intronic
1027353457 7:77334718-77334740 GTTGCCGGTGATGGGCTTCCTGG - Intronic
1027784016 7:82556481-82556503 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1027910236 7:84241115-84241137 ATACCCAGTAATGGGGTTGCTGG + Intronic
1028004878 7:85552483-85552505 ATACCCAGTTATGGGATTGCTGG - Intergenic
1028475947 7:91253252-91253274 GTACCCAGTAATGGGATTGCTGG + Intergenic
1028720166 7:94020879-94020901 GTGGCCTGTCATGGGGTTGGGGG + Intergenic
1029913264 7:104178080-104178102 GTACCCAGTAATGGGATTGCTGG + Intronic
1030019624 7:105260514-105260536 GTACCCAGTAATGGGATTGCTGG - Intronic
1030186019 7:106762831-106762853 GTACCCAGTAATGGGATTGCTGG - Intergenic
1030234811 7:107246850-107246872 ATAGCCAGTAATGGGATTGCTGG - Intronic
1030729979 7:112976080-112976102 GTGCCCAGTAATGGGATTGCTGG - Intergenic
1030772632 7:113493550-113493572 GTGCCCAGTAATGGGATTGCTGG - Intergenic
1030778498 7:113567226-113567248 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1031104075 7:117517566-117517588 GTACCCAGTAATGGGATTGCTGG + Intronic
1031128449 7:117803009-117803031 ATACCCAGTTATGGGTTTGCTGG - Intronic
1032951998 7:136925259-136925281 GATGCCAGATATCCGGTTGCTGG + Intronic
1033522717 7:142177879-142177901 ATACCCAGTAATGGGGTTGCTGG + Intronic
1033630158 7:143149751-143149773 GTACCCAGTAATGGGATTGCTGG - Intergenic
1033948424 7:146752135-146752157 GTACCCAGTAATGGGATTGCTGG + Intronic
1033950556 7:146780027-146780049 GTACCCAGTAATGGGATTGCTGG + Intronic
1034084206 7:148309086-148309108 ATAGCCAGTAATGGGATTGCTGG + Intronic
1034098404 7:148430576-148430598 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1034406524 7:150907074-150907096 ATGGCCAGTAATGGGATTGCTGG - Intergenic
1035488282 7:159248447-159248469 ATGGCCAGATATGGGATTGCTGG - Intergenic
1035539742 8:423803-423825 ATACCCAGTAATGGGGTTGCTGG + Intronic
1035540184 8:428704-428726 GTTACCAGGTCTGGGGGTGCTGG - Intronic
1035596682 8:863838-863860 GTAGCCAGTAGTGGGATTGCTGG - Intergenic
1036273334 8:7327912-7327934 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1036348015 8:7982440-7982462 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1036777286 8:11622369-11622391 GTTGGCAGTGAGGGGGTGGCAGG - Intergenic
1036864675 8:12385231-12385253 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1037114665 8:15209943-15209965 GATGGCAGTTATGGAGTTTCTGG + Intronic
1037945344 8:22986203-22986225 GTTGCCAGGGAATGGGTTGCTGG + Intronic
1038116749 8:24564393-24564415 GTAGCCAGTAATGGGATTGCTGG - Intergenic
1039007506 8:33056376-33056398 GTAGCCAGTAGTGGGATTGCTGG - Intergenic
1039367336 8:36944097-36944119 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1040366147 8:46718712-46718734 GTGCCCAGTAATGGGATTGCTGG + Intergenic
1040519403 8:48162144-48162166 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1040553240 8:48455562-48455584 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1040719155 8:50296244-50296266 ATTCCCAGTAATGGGATTGCTGG - Intronic
1040735621 8:50504366-50504388 GCTTCCAGTGATGGGATTGCTGG - Intronic
1040943957 8:52862273-52862295 GTACCCAGTAATGGGATTGCTGG + Intergenic
1040961552 8:53038927-53038949 GTATCCAGTAATGGGATTGCTGG + Intergenic
1040985450 8:53289546-53289568 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1041356123 8:57002474-57002496 ATACCCAGTAATGGGGTTGCAGG + Intergenic
1041424859 8:57709004-57709026 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1041652775 8:60317424-60317446 ATAACCAGTCATGGGGTTGCTGG - Intergenic
1042110211 8:65373645-65373667 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1042479329 8:69285838-69285860 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1042976189 8:74472447-74472469 GTTCCCAGTAATGGGATTGCTGG + Intronic
1043236135 8:77869503-77869525 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1043521196 8:81047204-81047226 ATACCCAGTAATGGGGTTGCTGG + Intronic
1043753296 8:83968791-83968813 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1043915270 8:85915355-85915377 GTACCCAGTAATGGGATTGCTGG - Intergenic
1044551733 8:93520240-93520262 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1044596435 8:93963236-93963258 GTACCCAGTAATGGGATTGCTGG + Intergenic
1044907705 8:97022860-97022882 GTAGCCAGTGGTGGGATTGCTGG - Intronic
1045673301 8:104580912-104580934 ATTCCCAGTAATGGGATTGCTGG - Intronic
1045716726 8:105055787-105055809 GTACCCAGTAATGGGATTGCTGG - Intronic
1046148567 8:110193621-110193643 ATTTCCAGTAATGGGATTGCTGG - Intergenic
1046410132 8:113831103-113831125 GTACCCAGTAATGGGATTGCTGG + Intergenic
1046572269 8:115981261-115981283 GTACCCAGTAATGGGATTGCTGG - Intergenic
1046573649 8:115998020-115998042 TATACCAGTTATGGGATTGCTGG + Intergenic
1046889607 8:119408046-119408068 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1047948530 8:129907435-129907457 GGTGCCTGTTATGGGGTGGGGGG + Intronic
1048017495 8:130510636-130510658 GTACCCAGTAATGGGATTGCGGG + Intergenic
1049128532 8:140814729-140814751 ATAGCCAGTAATGGGATTGCTGG - Intronic
1049660545 8:143817884-143817906 CTTGCCAGTTGTGGGGTCCCGGG + Exonic
1050167245 9:2778272-2778294 ATCCCCAGTAATGGGGTTGCTGG - Intronic
1050312119 9:4363908-4363930 GTTTCCAGTTATGAGGAAGCAGG + Intergenic
1050477045 9:6050975-6050997 ATGCCCAGTTATGGGATTGCTGG - Intergenic
1050637930 9:7632141-7632163 GTAACCAGTAATGGGATTGCTGG - Intergenic
1050684566 9:8153295-8153317 GTACCCAGTAATGGGATTGCTGG - Intergenic
1051292236 9:15556249-15556271 GCTGCCAGTGATGGGATGGCTGG + Intronic
1051301882 9:15660836-15660858 ATACCCAGTAATGGGGTTGCTGG + Intronic
1051331242 9:16026688-16026710 GATGACAGTTAAGGGGTTACTGG + Intronic
1051812287 9:21063507-21063529 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1051998893 9:23252400-23252422 GTATCCAGTAATGGGATTGCTGG - Intergenic
1052383322 9:27795343-27795365 ATACCCAGTTATGGGATTGCTGG + Intergenic
1052516949 9:29494222-29494244 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1053033237 9:34801277-34801299 GTACCCAGTAATGGGATTGCTGG - Intergenic
1053040777 9:34869264-34869286 GTACCCAGTAATGGGATTGCTGG + Intergenic
1054719267 9:68587695-68587717 GTACCCAGTAATGGGATTGCTGG + Intergenic
1055133575 9:72803863-72803885 GTACCCAGTAATGGGATTGCTGG - Intronic
1055301896 9:74891174-74891196 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1055363715 9:75522499-75522521 GTTTCCAGTTATGAGGATGTAGG - Intergenic
1055446221 9:76385152-76385174 GTTGCTGCTTATGGGGTTGGTGG + Intergenic
1055537366 9:77262943-77262965 GTACCCAGTAATGGGATTGCTGG + Intronic
1055819103 9:80240406-80240428 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1055988537 9:82079454-82079476 GTACCCAGTAATGGGATTGCTGG + Intergenic
1056669635 9:88615391-88615413 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1057317326 9:93978059-93978081 GTCACCAGCTATGGGCTTGCAGG - Intergenic
1057884598 9:98820608-98820630 GTACCCAGTAATGGGATTGCTGG + Intronic
1058156836 9:101525123-101525145 ATTCCCAGTAATGGGATTGCTGG + Intronic
1058226111 9:102365799-102365821 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1058327033 9:103711219-103711241 GTACCCAGTAATGGGATTGCTGG + Intergenic
1058353640 9:104056877-104056899 GTATCCAGTAATGGGATTGCTGG - Intergenic
1058353813 9:104058823-104058845 GTACCCAGTAATGGGATTGCTGG - Intergenic
1059062431 9:111047307-111047329 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1060103539 9:120859787-120859809 GATTCCAGTTCTGGGGTTGTTGG - Intronic
1060105458 9:120870137-120870159 TTGGCCAGTTGTGGGGTTGGGGG + Intronic
1060922870 9:127435001-127435023 GTTGGCAGTTTTGGGGGAGCTGG - Intronic
1185523558 X:759987-760009 GTACCCAGTCATGGGATTGCTGG - Intergenic
1185786275 X:2893628-2893650 GTACCCAGTAATGGGATTGCTGG - Intergenic
1185821632 X:3210483-3210505 GACTCCAGTTATGGGGTAGCAGG - Intergenic
1185985449 X:4827539-4827561 GTACCCAGTAATGGGATTGCTGG - Intergenic
1186688579 X:11951223-11951245 GTAACCAGTAATGGGATTGCTGG - Intergenic
1187184943 X:16975226-16975248 ATACCCAGTAATGGGGTTGCTGG + Intronic
1187373958 X:18734280-18734302 GGGGCCTGTTATGGGGTTGGGGG - Intronic
1187597283 X:20786590-20786612 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1188148267 X:26641088-26641110 GTACCCAGTAATGGGATTGCTGG + Intergenic
1188272221 X:28154017-28154039 ATAACCAGTAATGGGGTTGCTGG - Intergenic
1188462378 X:30443657-30443679 GTACCCAGTAATGGGATTGCTGG - Intergenic
1188730481 X:33639925-33639947 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1188874403 X:35412441-35412463 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1189435067 X:40985336-40985358 TATGCCAGTAATGGGATTGCTGG + Intergenic
1190133285 X:47770659-47770681 GTACCCAGTAATGGGATTGCTGG - Intergenic
1191086792 X:56576732-56576754 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1191651622 X:63544558-63544580 GTACCCAGTAATGGGATTGCTGG - Intergenic
1191733976 X:64369245-64369267 ATAGCCAGTAATGGGATTGCTGG - Intronic
1191888301 X:65912870-65912892 GTACCCAGTAATGGGATTGCTGG + Intergenic
1192019011 X:67364466-67364488 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1192889644 X:75375920-75375942 ATACCCAGTAATGGGGTTGCTGG + Intronic
1193135529 X:77967262-77967284 GTACCCAGTAATGGGGTTGCTGG + Intronic
1193622780 X:83777101-83777123 ATACCCAGTTATGGGATTGCTGG + Intergenic
1193626292 X:83825013-83825035 ATAGCAAGTAATGGGGTTGCTGG - Intergenic
1193661356 X:84262535-84262557 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1193718980 X:84965869-84965891 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1193782390 X:85719622-85719644 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1193844393 X:86450582-86450604 GTCCCCAGTAATGGAGTTGCTGG + Intronic
1193971139 X:88055125-88055147 ATTCCCAGTAATGGGATTGCTGG - Intergenic
1194055087 X:89121763-89121785 TATGCCAGTAATGGGATTGCTGG + Intergenic
1194183558 X:90742877-90742899 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1194322716 X:92471621-92471643 ATTCCCAGTAATGGGATTGCTGG + Intronic
1194376131 X:93136148-93136170 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1194575842 X:95613459-95613481 ATACCCAGTTATGGGATTGCTGG + Intergenic
1194753662 X:97712150-97712172 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1195124195 X:101788752-101788774 GTACCCAGTAATGGGATTGCTGG + Intergenic
1195844652 X:109212796-109212818 GTACCCAGTAATGAGGTTGCTGG - Intergenic
1195898582 X:109773560-109773582 GTGGACAGTAATGGGGTTTCGGG + Intergenic
1196080655 X:111627260-111627282 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1196095275 X:111791938-111791960 GTACCCAGTAATGGGATTGCTGG - Intronic
1196232256 X:113237860-113237882 ATTCCCAGTAATGGGATTGCTGG + Intergenic
1196486717 X:116219007-116219029 TATGCCAGTAATGGGATTGCTGG - Intergenic
1196516255 X:116615817-116615839 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1196874102 X:120141620-120141642 TATGCCAGTAATGGGATTGCTGG + Intergenic
1196946062 X:120827579-120827601 GTACCCAGTAATGGGATTGCTGG + Intergenic
1197107721 X:122735681-122735703 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1197478493 X:126952357-126952379 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1197624980 X:128791821-128791843 GTACCCAGTAATGGGATTGCTGG - Intergenic
1197625374 X:128796180-128796202 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1197682495 X:129401330-129401352 GTACCCAGTAATGGGATTGCTGG + Intergenic
1198068473 X:133123722-133123744 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1198194528 X:134346497-134346519 ATACCCAGTAATGGGGTTGCTGG + Intergenic
1198572858 X:137976598-137976620 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1198781758 X:140245389-140245411 ATTCCCAGTAATGGGATTGCTGG + Intergenic
1198838035 X:140825274-140825296 GTGCCCAGTAATGGGATTGCTGG + Intergenic
1199005506 X:142691919-142691941 GTTCCCAGTAATGGAATTGCTGG - Intergenic
1199067779 X:143440706-143440728 ATAGCCAGTAATGGGATTGCTGG + Intergenic
1199224265 X:145354320-145354342 GTATCCAGTAATGGGATTGCTGG - Intergenic
1199364629 X:146966014-146966036 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1199475497 X:148240570-148240592 ATAGCCAGTAATGGGATTGCTGG - Intergenic
1199935404 X:152568678-152568700 ATATCCAGTCATGGGGTTGCTGG - Intergenic
1200530167 Y:4324822-4324844 ATACCCAGTAATGGGGTTGCTGG - Intergenic
1200630868 Y:5585099-5585121 ATTCCCAGTAATGGGATTGCTGG + Intronic
1200825013 Y:7628291-7628313 ATGCCCAGTAATGGGGTTGCTGG + Intergenic
1201257292 Y:12121136-12121158 GACTCCAGTTATGGGGTAGCAGG + Intergenic
1201401167 Y:13605745-13605767 ATACCCAGTTATGGGATTGCTGG - Intergenic
1201563030 Y:15337728-15337750 GTACCCAGTAATGGGATTGCTGG + Intergenic
1202192076 Y:22255734-22255756 ATGCCCAGTAATGGGGTTGCTGG + Intergenic
1202235042 Y:22702796-22702818 ATGCCCAGTAATGGGGTTGCTGG - Intergenic
1202308117 Y:23493372-23493394 ATGCCCAGTAATGGGGTTGCTGG + Intergenic
1202562684 Y:26177214-26177236 ATGCCCAGTAATGGGGTTGCTGG - Intergenic
1202588777 Y:26460201-26460223 ATACCCAGTAATGGGGTTGCTGG + Intergenic