ID: 925362336

View in Genome Browser
Species Human (GRCh38)
Location 2:3288274-3288296
Sequence GTTTCAATGAGGTATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925362336_925362340 0 Left 925362336 2:3288274-3288296 CCACCCTCATACCTCATTGAAAC 0: 1
1: 0
2: 0
3: 20
4: 176
Right 925362340 2:3288297-3288319 ACTGAACCCAAAGCAAGTTTTGG 0: 1
1: 0
2: 2
3: 27
4: 180
925362336_925362341 1 Left 925362336 2:3288274-3288296 CCACCCTCATACCTCATTGAAAC 0: 1
1: 0
2: 0
3: 20
4: 176
Right 925362341 2:3288298-3288320 CTGAACCCAAAGCAAGTTTTGGG 0: 1
1: 0
2: 2
3: 17
4: 199
925362336_925362344 17 Left 925362336 2:3288274-3288296 CCACCCTCATACCTCATTGAAAC 0: 1
1: 0
2: 0
3: 20
4: 176
Right 925362344 2:3288314-3288336 TTTTGGGACTCTAGCAGTTTAGG 0: 1
1: 0
2: 0
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925362336 Original CRISPR GTTTCAATGAGGTATGAGGG TGG (reversed) Intronic
902809840 1:18881901-18881923 GTTTCAGTGATGCATGAGGATGG + Intronic
903533995 1:24054479-24054501 GTGACAGTGAGGTGTGAGGGAGG - Intergenic
905407665 1:37746445-37746467 GGTTAAATGAGATATAAGGGTGG - Intronic
906679850 1:47718920-47718942 GATTGAATCAGGTGTGAGGGGGG - Intergenic
906723398 1:48025610-48025632 GTTTTAATGAGGCCTCAGGGTGG - Intergenic
907060225 1:51414644-51414666 TTTTCTTTGGGGTATGAGGGAGG - Intronic
907757677 1:57326785-57326807 GATTCGATGAGGTCTGAGGATGG - Intronic
912375677 1:109207923-109207945 GTTGCAGTGAGCTATGATGGTGG + Intergenic
912593999 1:110855858-110855880 GTTGCCAAGAGGTAGGAGGGAGG + Intergenic
913111984 1:115665203-115665225 GATGTAATGAGGTATAAGGGTGG - Intronic
915254653 1:154617240-154617262 GTGGCAATGAGGGATGAGGTAGG - Intronic
916881413 1:169022817-169022839 GATTTAAAGAGGTGTGAGGGAGG - Intergenic
917633931 1:176917160-176917182 ATTACAATGAGGTATGACAGGGG - Intronic
918869357 1:189948760-189948782 GTATCAATGCATTATGAGGGTGG + Intergenic
920508680 1:206534917-206534939 GTTTGGATGAGGAAGGAGGGAGG - Intronic
922168191 1:223133389-223133411 GTTTCAAGGAGGTCTCAGGCGGG - Intronic
923448510 1:234094718-234094740 GCTTTTATGAGGCATGAGGGAGG + Intronic
1063056432 10:2509784-2509806 GGCTCAATGAGATATAAGGGTGG - Intergenic
1066125386 10:32336632-32336654 TTCTCTATGAGGTATGAGTGAGG - Intronic
1066264854 10:33766671-33766693 GTTTCAATGATGGAGGAGGCTGG + Intergenic
1066977935 10:42386510-42386532 CTTTCATTTAGGTGTGAGGGAGG + Intergenic
1067185530 10:44024088-44024110 GTTAAAATGAGGCATTAGGGTGG + Intergenic
1070187575 10:74080442-74080464 GATTCAATGAGGTAAGGAGGGGG + Intronic
1070556262 10:77529915-77529937 GTTTGAATGAGGTAAGAGGTGGG - Intronic
1070556602 10:77532661-77532683 GTTTCCATGGGGGAAGAGGGTGG + Intronic
1073014383 10:100386356-100386378 GTTTCAATGAGGGAGTAGGTGGG - Intergenic
1074048555 10:109861670-109861692 ATTTCAATGTGCTATGTGGGAGG - Intergenic
1076642699 10:131929598-131929620 GTTTCCACGAGGCATGAGGGAGG - Intronic
1078367563 11:10719357-10719379 ATTTCAATGAGTGAAGAGGGAGG - Intergenic
1078634541 11:13036760-13036782 CTTTCAAGGAGGTAAGAGGTGGG + Intergenic
1079527795 11:21411723-21411745 GATTCAATGAGGTATGATTCAGG + Intronic
1081536138 11:43997578-43997600 GTTTCAGGGAGGTTTGAGGAGGG + Intergenic
1084158311 11:67328547-67328569 GTTAAAATGAGGTCTTAGGGTGG + Intronic
1087134284 11:94699797-94699819 GTTAAAATGAGGTATTAGAGTGG + Intergenic
1087343133 11:96934555-96934577 GATTCAAAGAGGTATGTGGTGGG + Intergenic
1087756909 11:102063978-102064000 GTTTCAATGAGGTAGAAGGAGGG - Intronic
1087830156 11:102810923-102810945 GTTTCAGGGAGGCATGAGAGAGG + Intergenic
1089139339 11:116273611-116273633 GTTTCAATGAAGACTGAAGGAGG - Intergenic
1091385689 12:93227-93249 GCTTCACTGGGGTTTGAGGGTGG + Intronic
1091850341 12:3692342-3692364 GTTTGATTGTGGTATGAGGTGGG + Intronic
1092641249 12:10513067-10513089 TTTTGAATGAGGTAGGAGGACGG - Intronic
1097777636 12:63667541-63667563 GTTTCAGTGAAGTATGAGGCTGG - Intronic
1098403464 12:70098503-70098525 CTTTGCATGAGGTAAGAGGGAGG + Intergenic
1100795633 12:98179023-98179045 GTCTCAGTCAGGTATGAGGTTGG + Intergenic
1101915695 12:108894119-108894141 GTCTCAATGAGGAATCAGAGGGG - Intronic
1105213958 13:18273715-18273737 CTTTCAGTGAGTTTTGAGGGTGG - Intergenic
1105214653 13:18277229-18277251 GTTTGAGTGAGGTATGCGGGTGG - Intergenic
1107478605 13:40765333-40765355 TTTCCAATTAGGTATGAGTGAGG - Intronic
1107904257 13:45047627-45047649 ATTTGAATGAGGACTGAGGGAGG + Intergenic
1107967729 13:45612777-45612799 ATTTCAATGGGGGATCAGGGAGG + Intronic
1108856659 13:54800765-54800787 GTTTCACTGAGCTATGACCGAGG - Intergenic
1109506063 13:63305460-63305482 ATATCAATGAGGTGGGAGGGAGG - Intergenic
1109734727 13:66467883-66467905 GTTTCAATGAGAAATGAGCAAGG - Intronic
1110442381 13:75539618-75539640 GTTTCAATGAGTAATCAGGATGG + Intronic
1110863747 13:80372110-80372132 GTTGCTATGTGGGATGAGGGTGG + Intergenic
1111353430 13:87063979-87064001 GCTCCAATGAGCTATGATGGTGG - Intergenic
1113671793 13:112180690-112180712 TTTTCAATGAGGTTTGGTGGAGG + Intergenic
1115504671 14:34081745-34081767 GATTCCAAGAGGTCTGAGGGAGG - Intronic
1116629789 14:47315561-47315583 GTTTCATTAAGGAATGTGGGAGG - Intronic
1117033698 14:51704613-51704635 TTTTCAGTGAGGTGGGAGGGAGG + Intronic
1117464956 14:55983795-55983817 GTTTCAATTAGGATTGAGGATGG + Intergenic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1122085928 14:99304862-99304884 GTTTAAATAAGGTATGAAGGTGG - Intergenic
1122607454 14:102956765-102956787 GTTGCAGTGAGCTATGATGGTGG + Intronic
1123976959 15:25562942-25562964 GTTAAAATGAGGTCTTAGGGAGG - Intergenic
1127006959 15:54581588-54581610 GGTTAAATGAGGTAATAGGGTGG - Intronic
1127564981 15:60178577-60178599 CTTTCAAAGCAGTATGAGGGGGG + Intergenic
1128617121 15:69118828-69118850 GTTAGAATGAGGTAGGAGGAAGG - Intergenic
1128661459 15:69504186-69504208 GTTTCAGTGTGGAATGGGGGTGG + Intergenic
1128835663 15:70807328-70807350 GTTTCTATGTGGGATGGGGGTGG + Intergenic
1129383427 15:75182478-75182500 GTTTCAAACAGGAATGGGGGTGG + Intergenic
1132094002 15:98968733-98968755 GTTTCACTGAGGTTAGAGGCTGG - Intronic
1132770470 16:1559453-1559475 GTTTCTCCGAGGTATGAGGGTGG - Intronic
1135229757 16:20694803-20694825 GTTAAAATGAGTTATTAGGGTGG + Intronic
1138630318 16:58289070-58289092 GATTAAATGAGGTATAAGGCTGG + Intronic
1139065144 16:63303711-63303733 GTTGAAATGAGATATGAAGGGGG - Intergenic
1142508811 17:381524-381546 GTTTCCGGGAGGTATGAGGAGGG - Intronic
1148087700 17:45004390-45004412 GTTTCAAGGAGGTCTCAGTGTGG - Intergenic
1150297778 17:64022920-64022942 GTTTCAATGTGCTGTGAGGCTGG - Intergenic
1151144903 17:72031504-72031526 TTGGCAATGAGGGATGAGGGGGG - Intergenic
1151369010 17:73635728-73635750 AATTGAATGAGGTGTGAGGGTGG - Intronic
1152061301 17:78077668-78077690 GTTGCCATGAGGAAAGAGGGTGG - Intronic
1155510916 18:26575806-26575828 CTTTCAATGAGGCTTTAGGGAGG - Intronic
1157466220 18:47948322-47948344 CTTTTAGTGAGGTTTGAGGGTGG - Intergenic
1158968765 18:62646562-62646584 GTTTTATTGAGGGTTGAGGGAGG - Intergenic
1159579000 18:70213942-70213964 GTTTAAATGAGGTAATAAGGGGG - Intergenic
1162517325 19:11156431-11156453 GTTGCAATGAGCTATGATTGTGG - Intergenic
1165752353 19:38267978-38268000 ATTCCAATTAGGTAAGAGGGTGG + Intronic
925362336 2:3288274-3288296 GTTTCAATGAGGTATGAGGGTGG - Intronic
925707665 2:6702532-6702554 ATTCCAGTGAGCTATGAGGGTGG - Intergenic
927175239 2:20401359-20401381 GAATCAATGAAGTGTGAGGGAGG - Intergenic
929577452 2:43060899-43060921 GTTTCAAGGAAGTACAAGGGAGG - Intergenic
934299668 2:91769509-91769531 GTTTGAGTGAGGTATGTGGGTGG + Intergenic
934300365 2:91773034-91773056 CTTTCAGTGAGTTTTGAGGGTGG + Intergenic
935247011 2:101227325-101227347 GTGTCAATGAGCTAGAAGGGAGG + Intronic
935802777 2:106715153-106715175 GGTTAAATGAGGTATAAGGGTGG - Intergenic
938611278 2:132949742-132949764 TTTTCAATGAGGTATCAGAATGG - Intronic
942088590 2:172465714-172465736 GTTTCCATGAGGGAGGAGAGTGG + Intronic
942633903 2:177980913-177980935 TTCTCAATGAGACATGAGGGTGG + Intronic
943343139 2:186705408-186705430 GTTGCCATGAGGTAGGAGGCAGG - Intronic
943501565 2:188696050-188696072 TTTTCAATGAGTTATGAAGGAGG - Intergenic
944858844 2:203794984-203795006 GTTAACATGAGGTGTGAGGGTGG + Intergenic
948670499 2:239565501-239565523 GTGTGAATGAGGCATGAAGGAGG + Intergenic
949031246 2:241798538-241798560 GGTTGGATGAGGTTTGAGGGCGG - Intronic
1169289630 20:4337844-4337866 GTTTCAATGAGGGAAGAGCAAGG - Intergenic
1169610543 20:7375050-7375072 GCCTCAATGAGCTATGATGGTGG + Intergenic
1169847719 20:10013526-10013548 GTTTCAATGAAGAATGAAGATGG + Intronic
1170225559 20:13988143-13988165 GTGTATATGAGGTATGAGGTGGG + Intronic
1173698541 20:45045260-45045282 GTTTCTGTGAGGTAGCAGGGTGG + Intronic
1173828203 20:46060843-46060865 GGTTCAAAGAGGTTTGAGGCCGG + Intergenic
1173920359 20:46740165-46740187 CATTCAATGAAGTATGAGGCAGG - Intergenic
1175772169 20:61630744-61630766 GTTTCAAATGGGTATCAGGGAGG - Intronic
1177595616 21:23238058-23238080 GTTACAATGAGCTATGATAGTGG + Intergenic
1178030703 21:28522226-28522248 GGTTCAATGAGGAATAAAGGAGG + Intergenic
1179565542 21:42245605-42245627 GTTCCCATGTGGTGTGAGGGAGG + Intronic
1179962047 21:44773053-44773075 GTGTTGATGAGGTAGGAGGGAGG - Intronic
1181698023 22:24603606-24603628 GTTTGAGTGAGGTATGCGAGTGG + Intronic
1181991888 22:26843334-26843356 GTTTAAATGAGGTATCATGAGGG + Intergenic
1183153527 22:36056068-36056090 GTTTCAGTGAGGTTTCAGGAGGG + Intergenic
950428895 3:12939639-12939661 GTTCCAAAGAGGTAAGAGGGAGG - Intronic
951583925 3:24195837-24195859 CTGTCATTGAGGTTTGAGGGAGG + Intronic
952037324 3:29218397-29218419 GTTTCAATGGAGTATGAAGCAGG + Intergenic
953903210 3:46854883-46854905 GTCTCACTGAGGGATGAGGAAGG - Intergenic
955694809 3:61625116-61625138 GTTAAAATGAGGTATTAGGTTGG - Intronic
955801329 3:62689852-62689874 GTGACAATGAGAGATGAGGGGGG + Intronic
957034440 3:75280985-75281007 GTGTCAATCTGCTATGAGGGAGG + Intergenic
958214347 3:90543427-90543449 TTTTCTATGAGGTGTAAGGGAGG + Intergenic
958673218 3:97231674-97231696 GTTCCTCTGAGGTCTGAGGGAGG + Intronic
961078348 3:124002882-124002904 GTGTCAATCTGCTATGAGGGAGG + Intergenic
961305170 3:125953890-125953912 GTGTCAATCTGCTATGAGGGAGG - Intergenic
962127029 3:132631007-132631029 GTTTCAGTGAGCTATGATTGTGG + Intronic
962413993 3:135166290-135166312 GTTAAAATGAGGTTTGAGGATGG - Intronic
962539870 3:136370262-136370284 GTTCCAATGAGACATGTGGGAGG + Intronic
964992587 3:162832683-162832705 GTTTTAATAAGGTGTGAGGAAGG - Intergenic
966149396 3:176849958-176849980 GTTTCAATGAGGATTGACTGAGG + Intergenic
968654489 4:1772677-1772699 GTTTGACTGGGGGATGAGGGAGG + Intergenic
972984311 4:44745159-44745181 GTTTCTATAAGGTGTGAGGAAGG + Intergenic
978265508 4:106819651-106819673 GTTTAAATGAGGTCCGAGGGTGG - Intergenic
978812827 4:112870477-112870499 TTTTCCATATGGTATGAGGGAGG + Intronic
979076369 4:116275605-116275627 GTTTGATTGAGGTATAAGGTGGG - Intergenic
982942604 4:161576831-161576853 GTTTCAAGGAGGACTGAGGAAGG + Intronic
985848813 5:2373729-2373751 GAATGAATGAGGGATGAGGGAGG + Intergenic
986384313 5:7216746-7216768 GTAACACTGAGGTATGAGGAAGG + Intergenic
987219549 5:15775690-15775712 ATTTCAATGAGGCATGAGAATGG + Intronic
993854117 5:93051658-93051680 GCTTCTATGAGGTGTGTGGGTGG - Intergenic
994970605 5:106731561-106731583 GTTTCATTGTGGTATAAGGTGGG - Intergenic
995783490 5:115802984-115803006 ATCTAAATTAGGTATGAGGGAGG - Intergenic
996266560 5:121548372-121548394 ATTTCAATTAGATTTGAGGGTGG + Intergenic
999226497 5:150029372-150029394 GTTATAATGAGGTTTGAGGGAGG + Intronic
1000234548 5:159345334-159345356 TTTTCAATCAGCTTTGAGGGTGG + Intergenic
1001467902 5:171985299-171985321 GATTGGAGGAGGTATGAGGGTGG - Intronic
1002884342 6:1280720-1280742 GTTTAAAGGGGGAATGAGGGAGG + Intergenic
1002973425 6:2048950-2048972 GGTTAGATGAGGCATGAGGGTGG + Intronic
1003118610 6:3300722-3300744 TTTTCAAATAGGTATGAAGGAGG - Intronic
1003753314 6:9086955-9086977 TTTTCCATGAGCTTTGAGGGAGG - Intergenic
1004430865 6:15541767-15541789 GTTTTAATGGGGCATAAGGGTGG + Intronic
1004727508 6:18325468-18325490 GTTTCAGTGAGGAATGGGGGAGG + Intergenic
1006574607 6:35035584-35035606 GTGTCAATGTGACATGAGGGTGG - Intronic
1007536867 6:42599368-42599390 GTTACAGTGAGGTATGAGCCTGG + Intronic
1011695949 6:89912737-89912759 GGTTCAGTGAGCTATGAGGGTGG + Intergenic
1019053296 6:169201082-169201104 CTTTTGATGAGGAATGAGGGTGG - Intergenic
1021425739 7:20496886-20496908 GTTTGATTGTGGTATGAGGTGGG - Intergenic
1022701021 7:32760986-32761008 GTTTCAGTGAAGTATGAGACTGG - Intergenic
1022936567 7:35185205-35185227 GTTTCAGTGAAGTATGAGGCTGG - Intergenic
1026220200 7:68389357-68389379 GTTTCAATGATGTGAGAAGGAGG - Intergenic
1026632590 7:72050145-72050167 GTTTTAATAAGGCATAAGGGAGG + Intronic
1028176329 7:87663938-87663960 GGTGAAATGAGGTATAAGGGTGG - Intronic
1028373547 7:90120358-90120380 GTTTCAGTGAAGTATGAGGCTGG + Intergenic
1029832801 7:103279318-103279340 GTTTCAGTGAAGTATGAGGCTGG - Intergenic
1030905963 7:115182984-115183006 GGTTCAATGATTTATGAGGATGG + Intergenic
1032503113 7:132414825-132414847 GGTTCCATGAGGTGTGTGGGAGG - Intronic
1032713377 7:134482742-134482764 GTTTAGATGAGGTATGAGAGTGG - Intergenic
1034545719 7:151787398-151787420 GATTCAAAGAGATAGGAGGGTGG - Intronic
1036475906 8:9093088-9093110 GTTAAAATGAGGTAATAGGGTGG - Intronic
1036983027 8:13492566-13492588 GTTTGAATGACGTATAAGGCTGG - Intronic
1037846369 8:22286366-22286388 GTTTCTATGAGGTAAGAAAGCGG + Intronic
1038631969 8:29254162-29254184 TTTTGAATGTGGTATGAGGTAGG - Intronic
1039325021 8:36475401-36475423 GTTACATTGAGGTAGGAGGCAGG - Intergenic
1040067885 8:43163107-43163129 GTTGCAGTGAGGTGGGAGGGAGG + Intronic
1045721842 8:105121491-105121513 GTTTCAATGAGGTAGGATGATGG - Intronic
1046715879 8:117566613-117566635 GTTTCCATTATGTATGAGAGAGG + Intergenic
1048935932 8:139357070-139357092 GTTGAAAGGAGGTAAGAGGGTGG + Intergenic
1049905400 9:212102-212124 GTTGCAAAGAGGTATGTGTGGGG + Intergenic
1051056739 9:12996151-12996173 GTTTCTAGCAGGTATGATGGAGG + Intergenic
1051850033 9:21495495-21495517 TTTTCAATGGAGTATTAGGGTGG + Intergenic
1052902555 9:33806118-33806140 GTTGCAGTGAGCTATGATGGTGG - Intergenic
1056160780 9:83890316-83890338 CTCCCAATGGGGTATGAGGGAGG + Intronic
1056359357 9:85839006-85839028 CTCCCAATGGGGTATGAGGGAGG - Intergenic
1057611258 9:96545803-96545825 GATTCTATGATGTATGAGGCAGG - Intronic
1057718496 9:97514463-97514485 GTTTCAATGAAGTATGTGCCAGG + Intronic
1058021773 9:100098185-100098207 GTTGCAATAAGATTTGAGGGAGG + Intronic
1060980669 9:127789773-127789795 GTTTCCATGGGGTAGGAGGATGG + Exonic
1061520179 9:131113139-131113161 GCTTCAGTGAGAAATGAGGGAGG + Intronic
1190874151 X:54447831-54447853 GTTTTAAGGGGGTATGTGGGTGG + Intronic
1192459345 X:71303685-71303707 GATTCCATGAGGGGTGAGGGAGG + Exonic
1195507461 X:105674339-105674361 TTTTTAATAAGGTATGAGGAAGG + Intronic
1198420679 X:136468540-136468562 GGTTCAATGAGTCATAAGGGTGG + Intergenic