ID: 925363510

View in Genome Browser
Species Human (GRCh38)
Location 2:3295688-3295710
Sequence GAGGGTGTGCAGAGAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1559
Summary {0: 2, 1: 3, 2: 9, 3: 120, 4: 1425}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925363510 Original CRISPR GAGGGTGTGCAGAGAGAGGA GGG (reversed) Intronic
900002191 1:20877-20899 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
900021913 1:191401-191423 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900284450 1:1892246-1892268 CAGGGTGTGGAGAGAGTAGAAGG - Intergenic
900345465 1:2208357-2208379 GGAGGGGGGCAGAGAGAGGAAGG - Intronic
900500067 1:2999979-3000001 GGGGATGTGCTGGGAGAGGATGG + Intergenic
900503125 1:3016355-3016377 GAGGGAGGGAGGAGAGAGGAAGG + Intergenic
900541776 1:3206539-3206561 GAGGGTGAGCAGACTCAGGAAGG - Intronic
900725875 1:4216120-4216142 GGGGAGGTGCAAAGAGAGGAGGG - Intergenic
900829008 1:4950683-4950705 GAGGGGCTGCAGGGGGAGGATGG + Intergenic
900971874 1:5996347-5996369 GTGGGTGTGCAGGAAGAGGGAGG - Intronic
901163361 1:7197578-7197600 GGAGATGTGAAGAGAGAGGAAGG + Intronic
901220826 1:7582923-7582945 GATACTGTGCTGAGAGAGGACGG - Intronic
901224156 1:7602012-7602034 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
901258992 1:7857275-7857297 AAGGGTGAGTAGGGAGAGGAAGG - Intergenic
901504155 1:9673954-9673976 GTGGGCATGCAGAGACAGGAAGG + Intronic
901651814 1:10747267-10747289 TGGGGTCTGCAGAGAGAGGCAGG + Intronic
901740338 1:11338069-11338091 GAGGGGGAGGAGAGGGAGGAGGG - Intergenic
901773160 1:11541284-11541306 GAGGGGAGGCAGAGAGAGCAGGG + Intergenic
901844063 1:11971132-11971154 GAGGGAGTGGAGAGACTGGAAGG + Intronic
902215197 1:14930411-14930433 GAGGCTGTGCTGTGAGGGGAGGG - Intronic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
902786876 1:18738571-18738593 AAGGGAGTGGAAAGAGAGGATGG - Intronic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903045845 1:20563606-20563628 GTGGGGATGCAGAGAGGGGAGGG + Intergenic
903061323 1:20670727-20670749 GAGGGTGGGGACAGACAGGAAGG + Intronic
903323639 1:22556856-22556878 GAGGGTGTGCACAGAGGCCAGGG + Intergenic
903376620 1:22870452-22870474 GTGGGTGTGGAGAGGCAGGAGGG - Intronic
903404910 1:23088186-23088208 GAAGGTGAGCAGAGAGAGCTGGG + Exonic
903651928 1:24927778-24927800 GAGGGTGACCAGGGAAAGGAGGG + Intronic
904258872 1:29275612-29275634 GAGTGTGTGAAGACAGAGCAAGG + Exonic
904376637 1:30086049-30086071 AGGGGTCTGCAGAGAGAGGGAGG - Intergenic
904386873 1:30148664-30148686 GAGGGTGGGCAGATGGAGCAGGG + Intergenic
904704567 1:32380265-32380287 GAGAGTGGGCAGAGAGAGCAGGG - Intronic
904842205 1:33379659-33379681 GAGGGTGAGCACACTGAGGATGG - Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905040871 1:34957166-34957188 GAGGATGTGGAGAAATAGGAAGG + Intergenic
905182923 1:36177892-36177914 CAGGATGTGGAGGGAGAGGATGG - Exonic
905237940 1:36563087-36563109 GTGGGAGTCCTGAGAGAGGAAGG - Intergenic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906159994 1:43641022-43641044 GAGAGTGTGCAGAGAGCGGGTGG + Intergenic
906240567 1:44239787-44239809 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
906451245 1:45950067-45950089 GGGGGTGGAGAGAGAGAGGAGGG + Intronic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
906581852 1:46941464-46941486 GGGGGTGGTCAGAGAGAGGTAGG - Exonic
906601862 1:47137433-47137455 AGGGGTGGTCAGAGAGAGGAAGG + Exonic
906677287 1:47702256-47702278 GAGGGTGTGCTGGGTGTGGATGG + Intergenic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
907248472 1:53122662-53122684 GAGGGTGTGCTGAGACGAGATGG - Intronic
907303660 1:53502579-53502601 GAGGGAGAGAAGAGAGGGGAGGG + Intergenic
907372903 1:54014471-54014493 GAGGGTGAGCAGAGCAGGGATGG + Intronic
907497234 1:54853210-54853232 GAGGGGGTGCAGGGAGAAGAGGG + Intronic
908450009 1:64244706-64244728 GAGAATATGGAGAGAGAGGATGG - Intronic
908453448 1:64278935-64278957 GAGGATGTGGAGAAATAGGAAGG + Intergenic
908465507 1:64389615-64389637 GAGGATGTGGAGAAATAGGAAGG - Intergenic
908610928 1:65860189-65860211 GAGGGTGAGCGGTGAGGGGAGGG - Intronic
908630745 1:66104079-66104101 GAGGGTGGGGGGAGGGAGGAGGG - Intronic
908783884 1:67716111-67716133 GAGGGGCTGCACAGAGAGGTGGG + Intronic
909469300 1:76008826-76008848 GAGGGTGGGAAGAGAGAGGGAGG - Intergenic
909790244 1:79668253-79668275 GTGGGTGTGCATAGGGAAGAAGG - Intergenic
910042417 1:82868662-82868684 GAGAGTGAGGAGAGTGAGGAAGG + Intergenic
910285184 1:85545775-85545797 GAGGAGATGCAGAGGGAGGAGGG + Intronic
910571602 1:88711141-88711163 GAGGGTGGGGAGTGACAGGAGGG + Intronic
910689336 1:89949682-89949704 GAGGGTGTGCGGACATAAGAAGG + Intergenic
910803295 1:91165990-91166012 GTGCTTGTGCAGAGAGAGAAAGG + Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911276420 1:95864981-95865003 GAGTTTGTGGGGAGAGAGGAAGG - Intergenic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
912188155 1:107305365-107305387 GAGGATGTGGAGAAATAGGAAGG - Intronic
912230621 1:107788344-107788366 GAGAGTGGGCAGAGTGAGGGTGG - Intronic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912303106 1:108536814-108536836 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303109 1:108536823-108536845 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303112 1:108536832-108536854 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303115 1:108536841-108536863 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303133 1:108536896-108536918 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912303136 1:108536905-108536927 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912652428 1:111451206-111451228 GATGGTGTCAAGAGATAGGATGG - Intronic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913331603 1:117672352-117672374 GAGACAGTGCAGAGAGAGAAGGG - Intergenic
913380085 1:118201161-118201183 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
913542116 1:119831399-119831421 GAGGGTGGGAAGTGGGAGGAGGG + Intergenic
914005384 1:143728535-143728557 GAGGGCCTGAAGAAAGAGGAAGG + Intergenic
914097864 1:144559794-144559816 GAGGGCCTGAAGAAAGAGGAAGG + Intergenic
914276585 1:146130043-146130065 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914291703 1:146280067-146280089 GTGGGTGTGCAGAGATGAGATGG - Intergenic
914537630 1:148580998-148581020 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914552747 1:148730850-148730872 GTGGGTGTGCAGAGATGAGATGG - Intergenic
914586545 1:149067451-149067473 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914716525 1:150258916-150258938 GTGGGTGTCCAGAGAGCAGAAGG + Intronic
914784742 1:150818056-150818078 GAGGGGGTGGAGAGGGAGGAAGG + Intronic
915048589 1:153042081-153042103 GTAGGTGTGCAGAGTGAGGAAGG + Intergenic
915170169 1:153972160-153972182 GAGGATGTACGGAGAGTGGATGG - Intronic
915288519 1:154867948-154867970 GAGGGAGTGGAGATGGAGGAAGG - Intronic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915363479 1:155300334-155300356 GAGGGTATGCTGAGAGACGAAGG - Intronic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916158124 1:161878469-161878491 GAGAGTATATAGAGAGAGGAGGG + Intronic
916288423 1:163136259-163136281 GAGGTTGTGGAGAAATAGGAAGG - Intronic
916432535 1:164744890-164744912 GTGGGTGGGAAGAGAAAGGAGGG + Intronic
916452152 1:164931104-164931126 GAGTGAGAGCAGAGAGAGTAGGG - Intergenic
916456651 1:164977787-164977809 AAGGGTGTGCAGGAAGGGGAAGG + Intergenic
916943701 1:169702602-169702624 GTGGATGAGCAGAGAGAGGCAGG - Intronic
917257346 1:173129905-173129927 GAGGATGTGGAGAAATAGGAAGG - Intergenic
917329601 1:173868225-173868247 GAGGAAGAGCAGAGAGGGGAGGG + Intronic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
918008314 1:180562713-180562735 TGGGGTGTGCACAGAGAGGAAGG + Intergenic
918106174 1:181417102-181417124 GAGGGAGTGGAGAGAAAAGAGGG - Intronic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
919055572 1:192565762-192565784 GAGGAGGTGGAGAGGGAGGAAGG + Intergenic
919600291 1:199614055-199614077 GAGGGTGGAGAGTGAGAGGAGGG - Intergenic
919665276 1:200285559-200285581 GAGAGAGAGAAGAGAGAGGAAGG + Intergenic
919691346 1:200531207-200531229 GAAAGTCTGCAGAGAGCGGAAGG - Intergenic
919754929 1:201060857-201060879 GTGGGTGTGGAGAGGGAGGGAGG - Intronic
919846969 1:201648553-201648575 GAGGAGGGGGAGAGAGAGGACGG - Exonic
920029404 1:203027352-203027374 GTGGGTGGGAAGAGAGAGGTCGG + Intronic
920230448 1:204466488-204466510 GTGGGGGTGCACAGAGGGGAGGG + Intronic
920234277 1:204492708-204492730 GGGGGTGTGCTGGGTGAGGAAGG - Intronic
920269845 1:204754729-204754751 AAGGGTGTGAAGAGAGGGAATGG - Intergenic
920402227 1:205683140-205683162 GGGGGAGGGAAGAGAGAGGAAGG - Intergenic
920859901 1:209697290-209697312 GAGTGTGTGGGGAGAGGGGAGGG - Intronic
921058549 1:211563399-211563421 GAGGGTTTGCCTAGAAAGGAAGG - Intergenic
921438275 1:215153738-215153760 GAGGGTGGGGAGTGAGGGGAGGG - Intronic
921699206 1:218248110-218248132 GAGGGTGAGCAGGGGGAGGTTGG + Intergenic
922037751 1:221866012-221866034 GAGGTTGTGCAGACAGCTGAAGG + Intergenic
922621500 1:226992008-226992030 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
922621506 1:226992026-226992048 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
923070652 1:230561652-230561674 GAGGGTATGCTGCGAGCGGAGGG + Intergenic
923265086 1:232306503-232306525 GAGTGTGGGAAGGGAGAGGAAGG - Intergenic
923706173 1:236346616-236346638 AAGTGTGTGCAAAGAGAGGTGGG - Intergenic
924399523 1:243663458-243663480 GAGGCAGTGCAGGGAGGGGAGGG + Intronic
924823188 1:247513807-247513829 GAGGGTGAGCAGAAAGAGGGTGG - Intronic
1063001875 10:1932340-1932362 GAGGGGGAGAAGAGAGAGGGAGG + Intergenic
1063225768 10:4013453-4013475 GAGGGAGGGAGGAGAGAGGAAGG - Intergenic
1063352314 10:5366842-5366864 GAGGGTTTGCAGAGAGAGAAAGG + Intronic
1063419032 10:5896384-5896406 GAGGGTTAGCAAAGAGAGGTGGG + Intronic
1063454505 10:6173720-6173742 GCGGGGGTGCAGAGAGAGGGAGG + Intronic
1063517655 10:6712333-6712355 AAAGGGGTGCAGGGAGAGGAGGG + Intergenic
1063691885 10:8295572-8295594 GAGGAAGGGGAGAGAGAGGAAGG - Intergenic
1064011182 10:11737788-11737810 GTGGGTGAGCAGAGGGAGGGAGG - Intergenic
1065645196 10:27826687-27826709 GAGGATGTGGAGAGGGAGGCAGG - Intronic
1065728772 10:28691716-28691738 GAGGGAGTGGAGAGGGGGGATGG - Intergenic
1065798530 10:29329707-29329729 GTGTGTGTGAAGAGAGAGAAGGG + Intergenic
1065857020 10:29839054-29839076 GAAGGGGTGCAGGGAGAGAAAGG + Intergenic
1065991080 10:31011151-31011173 CAGGCTGAGCAGAGAGAGCATGG + Intronic
1066219936 10:33326464-33326486 GAAGGTGTTGAGGGAGAGGAAGG - Intronic
1066361192 10:34733008-34733030 GAGGGAGTTCAAAGAGAGGGTGG - Intronic
1066502427 10:36007089-36007111 GAGGGTGGGGAAAGGGAGGAGGG - Intergenic
1067203203 10:44192684-44192706 GAGAGTGTCCAGACAGAAGATGG - Intergenic
1067337898 10:45379279-45379301 GAGGGGCTGGAGAGGGAGGAAGG - Intronic
1067706257 10:48608396-48608418 GGAGGTGTGCAGCTAGAGGAGGG + Intronic
1067728877 10:48794558-48794580 GAAGCTGTACAGAGAGAAGAAGG + Intronic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1067984290 10:51124371-51124393 GGGGGTGTGGAGTGGGAGGATGG + Intronic
1068318622 10:55381053-55381075 GAGGCTGAGCAATGAGAGGAGGG + Intronic
1068685892 10:59869678-59869700 GTGGGTGTGCAGAATGAGCACGG - Intronic
1068709771 10:60121332-60121354 GAGGGAGTGCAGGGGGTGGAGGG + Intronic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068933516 10:62614753-62614775 GAGGGGGTTCACTGAGAGGAGGG + Intronic
1069526807 10:69179900-69179922 GTGGGTGAGCAGTGAGAGAATGG - Intergenic
1069604837 10:69732550-69732572 GGTGGGGTCCAGAGAGAGGAGGG - Intergenic
1069691816 10:70358693-70358715 GCTGGTGGGCAGAGAGGGGAGGG - Intronic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1069828832 10:71270563-71270585 TAGGGAGCCCAGAGAGAGGAAGG + Intronic
1069899741 10:71700659-71700681 GAGGCTGGGAAGGGAGAGGAGGG + Intronic
1069914832 10:71781017-71781039 GAGGTTGTGGAGGGAAAGGAGGG + Intronic
1069929137 10:71870441-71870463 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069929140 10:71870450-71870472 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069929143 10:71870459-71870481 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069929146 10:71870468-71870490 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1069956231 10:72053679-72053701 GAAGGGGTGCAGGGAGAGAAAGG + Intergenic
1069959364 10:72070548-72070570 GAGGGTGGGCAGGGGCAGGAAGG - Intronic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070333252 10:75432591-75432613 CAGGGTGTGCAGGGAAAGGTGGG - Intronic
1070440048 10:76434362-76434384 GAGGGAGTGAAGAGATAGGAGGG - Intronic
1070714282 10:78707931-78707953 GAGGGTGTGCATACAGAAGGAGG - Intergenic
1070994966 10:80770150-80770172 GTGGGGGTGCAAAGAGAGGAAGG + Intergenic
1071001527 10:80836408-80836430 GAGGATGTGAAGAAATAGGAAGG - Intergenic
1071384496 10:85105759-85105781 GAGGGAGTGCCCAGCGAGGAAGG + Intergenic
1071690910 10:87818590-87818612 GAGGGTTTGCACAGAGTGGTGGG - Intronic
1071815897 10:89232558-89232580 GAGAGTGTCCAGAGAAAGGCAGG + Intronic
1072570077 10:96650833-96650855 GGGAGTGTGGAGAGAGATGAGGG + Intronic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073443765 10:103568744-103568766 GATGGTGTGGGGAGAGAGGCAGG - Intronic
1073694457 10:105849502-105849524 GAGGGTGAGCTGAAAGAGGGTGG + Intergenic
1074207452 10:111296272-111296294 GAGGGCTTGCAGAGAAATGAGGG + Intergenic
1074532131 10:114305213-114305235 GAGGGCATGCAGATAAAGGAGGG + Intronic
1074532213 10:114305513-114305535 GAGGGGGTGCAGGTACAGGAGGG + Intronic
1074781142 10:116803222-116803244 GAGGGTGTGCGGAGAGAATTCGG + Intergenic
1074824090 10:117202150-117202172 CAGGGGTTGCAGAGAGAGGCTGG + Intronic
1074867595 10:117553891-117553913 GAGGGTGTGGAGAGATGGGGAGG - Intergenic
1074894338 10:117762008-117762030 GCGGGGGTGAAGAGTGAGGAGGG + Intergenic
1074899558 10:117804406-117804428 GCAGGGGTGCAGAGAGAAGAGGG + Intergenic
1074979369 10:118607588-118607610 GAGGGTGGACAGGGAGAGGAGGG - Intergenic
1075044894 10:119139139-119139161 GAGGGTCTACAGGGAGGGGAGGG + Intergenic
1075169689 10:120101856-120101878 GAGAGAATCCAGAGAGAGGATGG + Intergenic
1075559518 10:123458441-123458463 GAAGGGAGGCAGAGAGAGGAGGG - Intergenic
1075826893 10:125365031-125365053 GAAGGAGAGGAGAGAGAGGATGG + Intergenic
1075837521 10:125467798-125467820 GAGGGTGTGCCAAGAGAGGCAGG - Intergenic
1076304423 10:129454426-129454448 GAGGTGGTGCAGTGACAGGAGGG + Intergenic
1076313997 10:129527977-129527999 GAGGAGGTGCTGAGAGAGAAGGG - Intronic
1076411107 10:130251624-130251646 GGGGGTGAGGAGAGAGAGGAAGG - Intergenic
1076463782 10:130664642-130664664 GAGGGTGGGAAGAAAGAGCAAGG + Intergenic
1076561957 10:131372881-131372903 GAGGGTGTGGAGAGTGCTGATGG - Intergenic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077020249 11:414084-414106 GAAGGTGTGCAGGGAAAGGTGGG - Intronic
1077020300 11:414238-414260 GAAGGTGTGCAGGGAAAGGTGGG - Intronic
1077218799 11:1406138-1406160 GCGGCTGGGCAGGGAGAGGAAGG - Intronic
1077278321 11:1728425-1728447 GAGGCTGGGCACGGAGAGGAGGG - Intergenic
1077332159 11:1988505-1988527 GAGGGTGAGGAGGGAGAGGAGGG + Intergenic
1077518287 11:3015681-3015703 GTGGGTGGGCAGACAGAGGAGGG + Intronic
1078072001 11:8120052-8120074 GAGGATGTGGAGAAATAGGAAGG + Intronic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078184645 11:9041384-9041406 GAGAGTGTGAAGACAGAGGAAGG + Intronic
1078349893 11:10583931-10583953 GAAGGTCTGTGGAGAGAGGAGGG + Intronic
1078523134 11:12079381-12079403 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1079136275 11:17777468-17777490 GAGGGTGTTGGGAGAGGGGAGGG - Intronic
1079929528 11:26540808-26540830 GAGGATGTGGAGAAATAGGAAGG + Intronic
1080419042 11:32093964-32093986 GAGGGGGAGAAGAGAGAGGTAGG + Intronic
1080814054 11:35736842-35736864 AAGGGAGTGAAGAGTGAGGAAGG - Intronic
1081111509 11:39139562-39139584 AAGGGTGAGCAGAGATAGTAGGG - Intergenic
1081989385 11:47329592-47329614 GAGGAAGGGCACAGAGAGGAAGG + Exonic
1082140879 11:48607699-48607721 GGAGGTGTGCAGAGAGAGTTTGG - Intergenic
1082568049 11:54704473-54704495 GGAGGTGTGCAGAGAGAGTTTGG - Intergenic
1082772089 11:57215554-57215576 GAGGGTGGGGGGTGAGAGGAGGG + Intergenic
1082859329 11:57839075-57839097 GAGGGTGGAGAGTGAGAGGAGGG + Intergenic
1083010300 11:59390831-59390853 GAGGGTGTAGGGTGAGAGGAAGG + Intergenic
1083533782 11:63449927-63449949 GGGGGTGGGCAGAAAGGGGAGGG - Intergenic
1083643349 11:64157741-64157763 GATGGTGTTCAGAGAGGTGAGGG + Intronic
1083808652 11:65089861-65089883 GAGGCTGTGCTGAGTGAGCAGGG + Intronic
1083815507 11:65130374-65130396 GGGGGACTGCAGAGAGAAGACGG + Exonic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1084717389 11:70882671-70882693 GTGGCGGTGCAGGGAGAGGACGG + Intronic
1084932924 11:72571251-72571273 GGGGGTGTGCTGAGGAAGGATGG - Intergenic
1085192470 11:74640013-74640035 TAGGATGTGCAGAGAGTGGGTGG + Intronic
1085236292 11:75018054-75018076 GTGGGTGGGGAGAGAAAGGAAGG - Intronic
1085324717 11:75597761-75597783 TAGGGTGTGCTTAGAGAGCAGGG + Intronic
1085446336 11:76603551-76603573 GAGAGAGGGGAGAGAGAGGAAGG + Intergenic
1085728687 11:78977716-78977738 GAGGATGTGGAGAAAGAGGAAGG + Intronic
1086548148 11:88022999-88023021 GAGGGTATAGAGTGAGAGGAAGG + Intergenic
1086746358 11:90432418-90432440 GAGGGTGGGAGGAGAGAGAAGGG - Intergenic
1086885822 11:92204693-92204715 GAGGGGGTGGAAAAAGAGGAGGG - Intergenic
1087093674 11:94300151-94300173 GAGGGAGAGGAGAGAGAGAAGGG + Intergenic
1087245851 11:95835891-95835913 GAGGTTATCCAGACAGAGGAGGG + Intronic
1087588573 11:100154651-100154673 GAGGATGTGGAGAGATTGGAGGG - Intronic
1088575181 11:111264746-111264768 GAGGGAGGGAAGAGACAGGAAGG + Intronic
1089176272 11:116551112-116551134 GAGGGTGTGAGATGAGAGGATGG + Intergenic
1089345942 11:117791809-117791831 GAGAGGGGGCAGGGAGAGGAAGG + Intronic
1089479397 11:118792138-118792160 GAGCGTGCGCCGGGAGAGGACGG + Intergenic
1089529525 11:119117266-119117288 AGGGGTGTGCAGAGAAAGGATGG + Exonic
1089627226 11:119759077-119759099 GGGAGTGTTTAGAGAGAGGAAGG - Intergenic
1089683205 11:120130953-120130975 TAGGGAGTGCATAGAGAGGCTGG + Intronic
1089709001 11:120301718-120301740 GAGAGAGGGCTGAGAGAGGAGGG - Intronic
1090089672 11:123683934-123683956 GAGGGTGTGGGGATAGAAGAAGG - Intergenic
1090182401 11:124711842-124711864 GAGGGGTTGTAGGGAGAGGATGG - Intergenic
1090353283 11:126121550-126121572 GGGAGTGTGCAGAGGGAGGAGGG + Intergenic
1090450059 11:126798239-126798261 CAGTGTGTTCTGAGAGAGGAAGG - Intronic
1090590567 11:128262544-128262566 GAGGATGCACAGAGAGAAGACGG - Intergenic
1090785635 11:130044877-130044899 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1090785638 11:130044886-130044908 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1090785641 11:130044895-130044917 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1090949868 11:131464096-131464118 GAGGGGCTGCTGAGGGAGGAGGG + Intronic
1202815140 11_KI270721v1_random:43681-43703 GAGGGTGAGGAGGGAGAGGAGGG + Intergenic
1091375606 12:22937-22959 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
1091386418 12:98856-98878 GAGGGCGTGCAGAAGTAGGAAGG + Intronic
1091448807 12:560122-560144 GAGAAGGGGCAGAGAGAGGATGG + Intronic
1091583932 12:1805346-1805368 GAGGCTGTGCCCAGAGAGAAGGG + Intronic
1091644736 12:2264930-2264952 AAGGGTTTGCAGAGAGTGAAAGG - Intronic
1091696454 12:2631263-2631285 GAGGAGGAGGAGAGAGAGGAAGG - Intronic
1091820348 12:3471295-3471317 TGGGGTTTGCAGAGAGAGTAGGG - Intronic
1091855521 12:3736224-3736246 GTGGCAGTGCAGAGAGAGGAGGG + Intronic
1091893991 12:4085500-4085522 GGTGGTCTTCAGAGAGAGGATGG - Intergenic
1091997933 12:5009920-5009942 GAGGCTCTGCAGTGGGAGGATGG - Intergenic
1092046371 12:5433845-5433867 GAGGGCCTGCTGAGAGGGGAGGG + Intronic
1092091713 12:5809129-5809151 GAGGGAGTGCAGATGGGGGAAGG + Intronic
1092141145 12:6184330-6184352 GTGGCTTTGCAGACAGAGGAGGG - Intergenic
1092155203 12:6277998-6278020 GAGGGGGAGGAGGGAGAGGAGGG + Intergenic
1092181056 12:6447266-6447288 AAGGGTCTGCAGAGTGAGTAGGG - Intronic
1092273198 12:7039304-7039326 GAGAGTGTGCAGTGAAGGGAGGG - Intronic
1092850187 12:12619067-12619089 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1092892108 12:12978691-12978713 GAGGGAGGTAAGAGAGAGGAAGG + Intronic
1092960652 12:13594036-13594058 GAGGATGTGGAGAAATAGGAAGG + Intronic
1093946959 12:25120285-25120307 GAGGGTGAGAAGAGAGAGAGAGG + Intronic
1094073771 12:26450145-26450167 GAGGGCCTTCAGAGAGAGCATGG + Intronic
1094083832 12:26566475-26566497 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1094423533 12:30296566-30296588 GAGGGTTTCCTAAGAGAGGAAGG + Intergenic
1094537880 12:31337964-31337986 GTGGGTGTGCAGAGCGATGCTGG - Intergenic
1094587795 12:31793980-31794002 GAGGGTCTGCACAGAGATTATGG - Intergenic
1095041413 12:37445119-37445141 GGGGGTGTGGAGCAAGAGGAGGG + Intergenic
1095867435 12:46988005-46988027 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1096239802 12:49953744-49953766 GATGGTCTACAGACAGAGGAAGG + Intronic
1096774745 12:53957022-53957044 GAGGCTGGGAAGAGAGAGGAGGG + Exonic
1096836653 12:54355589-54355611 GGGGGTGGGCAGTGAGGGGATGG - Intergenic
1096859042 12:54509861-54509883 GAGGAAATGCAAAGAGAGGAGGG - Exonic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1097311608 12:58124963-58124985 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1097342269 12:58452847-58452869 GAAGGAGTGCAGAGAGATGGAGG + Intergenic
1097797660 12:63880919-63880941 AAGAGTGTGCAGATAAAGGAAGG - Intronic
1098038988 12:66335293-66335315 GAGAGACTGCAGATAGAGGAGGG + Intronic
1098212126 12:68177542-68177564 GAGGGTAAGAAGAGAGAGGGAGG + Intergenic
1098400504 12:70070338-70070360 GAGGATGTGCAAAGAGAAGAGGG - Intergenic
1098404052 12:70105152-70105174 GAGGGTGTGTGCAGAGAGGCGGG - Intergenic
1098499139 12:71170201-71170223 GAGGGGTTGCAGGGAGAGGTGGG + Intronic
1099445453 12:82746520-82746542 GATGGGGGGCAGAGAAAGGAAGG - Intronic
1099540227 12:83899032-83899054 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1100110660 12:91238172-91238194 GAGGGTGGGGAGAAAGGGGAGGG - Intergenic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100383713 12:94085953-94085975 GAGGATGTGCATAGGGAAGATGG + Intergenic
1100517346 12:95341180-95341202 GAGTGTGTGAAGAGAGTGAATGG - Intergenic
1100739286 12:97573353-97573375 GAGGGTGGGAAGAGATGGGAAGG - Intergenic
1101001013 12:100357183-100357205 GGTGGGGAGCAGAGAGAGGAGGG + Exonic
1101056869 12:100926658-100926680 AAGGGTGAGAATAGAGAGGAAGG - Intronic
1101195781 12:102380702-102380724 GTGGATGTGGAGAAAGAGGATGG + Intergenic
1101299526 12:103464203-103464225 GAGGCTGTGGAGAAATAGGAAGG - Intronic
1101492492 12:105222444-105222466 CAGGGTGTGGTGAGTGAGGAAGG + Intronic
1101570479 12:105948992-105949014 GAGGCAGTGCAGTGAGGGGAGGG - Intergenic
1101788716 12:107909669-107909691 GAGGGTGGGGAGTGGGAGGAGGG - Intergenic
1101838381 12:108310838-108310860 GCGGGTAGGCAGAGACAGGAGGG + Intronic
1102212627 12:111138361-111138383 GTGGGGGTGGGGAGAGAGGAGGG + Intronic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1103715918 12:122945270-122945292 GAGGGTTTGGAGTGAGAGGGAGG - Intronic
1103855120 12:123962641-123962663 GATGGGGAGTAGAGAGAGGAAGG + Intronic
1103912388 12:124359666-124359688 GAGAGTTGGGAGAGAGAGGAGGG + Intronic
1104376622 12:128268870-128268892 GAGGGTGGGGTGAGAGAGGGGGG + Intronic
1104376637 12:128268922-128268944 GAGGGTGGGGCGAGAGAGGGGGG + Intronic
1104464840 12:128981985-128982007 AAGGGTATTCAGGGAGAGGAGGG - Intronic
1104601152 12:130154343-130154365 GAGTGGGTGCAGAGAGCTGAGGG - Intergenic
1104655302 12:130569958-130569980 GAGTGTGTGCAGAGTAAGGTAGG - Intronic
1105273948 13:18904052-18904074 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1105418765 13:20234694-20234716 GTGGGGGTGGAGAGAGAGGAAGG + Intergenic
1105994063 13:25653450-25653472 GAGGGTGGAGAGTGAGAGGAAGG + Intronic
1106374922 13:29176871-29176893 GTGACTGTCCAGAGAGAGGAGGG - Intronic
1106481448 13:30140195-30140217 AAGTGTGTGGAGGGAGAGGAAGG - Intergenic
1107277984 13:38698634-38698656 GTGAGAGAGCAGAGAGAGGAAGG + Intronic
1107401895 13:40077241-40077263 GAAGGAGTGAAGAAAGAGGAAGG + Intergenic
1107448066 13:40485714-40485736 GAGGAGGTGTAGAGAGAAGAAGG - Intergenic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1107518674 13:41157909-41157931 GAGGGTGGCAAGAGAAAGGAGGG + Intergenic
1107584911 13:41835081-41835103 GAGGGTGAGAGGAGGGAGGAGGG + Intronic
1107790156 13:43993999-43994021 GAGGGTGGAGAGTGAGAGGACGG + Intergenic
1108212751 13:48154872-48154894 CTGGTTGTGCAGAGAGGGGAGGG + Intergenic
1108462191 13:50677896-50677918 GGGAGTCGGCAGAGAGAGGAGGG - Intronic
1108631512 13:52288222-52288244 GAGGAGGTGCAGAGAGAGAGGGG - Intergenic
1108655180 13:52524373-52524395 GAGGAGGTGCAGAGAGAGAGGGG + Intergenic
1109958134 13:69595354-69595376 GAGGGAGAGCAGGGTGAGGAGGG + Intergenic
1110534832 13:76639028-76639050 GTGAGTCTGAAGAGAGAGGAAGG - Intergenic
1110765898 13:79279315-79279337 GATGGTATGGAGAGAGAGAATGG - Intergenic
1110873052 13:80474870-80474892 GTGGGTGTGGAGAGAGAAGGCGG + Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111296861 13:86290484-86290506 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1111356749 13:87116262-87116284 GAGGGTGGAAAGTGAGAGGAGGG + Intergenic
1111414854 13:87926822-87926844 GAGGGTGTGGAGTGGGAAGAGGG + Intergenic
1111717658 13:91899820-91899842 GAGGGTCTTCAGAGGGAGTATGG + Intronic
1112030787 13:95454527-95454549 CAGGGTGGGGAGAGAGGGGAGGG - Intronic
1112166337 13:96924222-96924244 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1112819088 13:103309988-103310010 GAAGGTGTGGAGAGAGAGTGTGG + Intergenic
1112900551 13:104352488-104352510 GAGGGGGGGAAGGGAGAGGAGGG - Intergenic
1113090471 13:106612780-106612802 GGGGGAGTAGAGAGAGAGGATGG - Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113271270 13:108677129-108677151 GGGGATGTGCAGAAGGAGGAGGG + Intronic
1113397109 13:109958133-109958155 GAGGGTGGAGAGAGGGAGGAAGG - Intergenic
1113618497 13:111697375-111697397 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113624026 13:111782636-111782658 GAAGGGAGGCAGAGAGAGGAAGG - Intergenic
1113646985 13:112005091-112005113 CAGGCTGTGCAGTGAGTGGAGGG - Intergenic
1113680189 13:112238548-112238570 GAGGAGGTGCCGAGAGCGGAGGG - Intergenic
1113754816 13:112803920-112803942 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754849 13:112804021-112804043 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754871 13:112804081-112804103 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754891 13:112804134-112804156 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754906 13:112804178-112804200 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754927 13:112804230-112804252 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754944 13:112804273-112804295 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113754987 13:112804386-112804408 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113755011 13:112804448-112804470 GAAGGAGGGCAGAGAGGGGATGG - Intronic
1113755589 13:112808688-112808710 GATGGTGTGAAAAGAGAGGCGGG - Intronic
1113871843 13:113564661-113564683 GAGGGTTTGAAGGGAGGGGAGGG - Intergenic
1114523406 14:23352595-23352617 GCGGGGGTGCTGGGAGAGGATGG + Intronic
1114544140 14:23486198-23486220 GAGGGTGTGAAGCCAGATGAAGG - Intronic
1114603554 14:23976466-23976488 GAGGATGTGGAGAAATAGGAAGG + Intronic
1114608566 14:24019240-24019262 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1114706515 14:24732493-24732515 GAGGGTGGGGAGTGAGGGGAGGG + Intergenic
1115147367 14:30240859-30240881 GAGGGGGTGGAGAGAGATGGAGG + Intergenic
1115928100 14:38460138-38460160 GTGGCTGAGCAGAGAGAGCAAGG + Intergenic
1116198693 14:41762115-41762137 CAGGGTGTGAAGACAGAGGGTGG - Intronic
1116232442 14:42234867-42234889 GATGGGGGGCAGACAGAGGATGG - Intergenic
1116355163 14:43919245-43919267 GAGGGTGGAGAGTGAGAGGAGGG - Intergenic
1116558690 14:46347590-46347612 GAGGGTGGAGAGAGGGAGGAGGG + Intergenic
1117076919 14:52114366-52114388 GAGGGTGTGCAAAGTTTGGAAGG - Intergenic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117931457 14:60846100-60846122 GAGGGAGGGAAAAGAGAGGAAGG - Intronic
1118224302 14:63884628-63884650 GAGTGTGTGCAAAGACGGGAAGG + Intronic
1118347907 14:64953041-64953063 CAGACTGTGGAGAGAGAGGAGGG + Intronic
1118767598 14:68920634-68920656 AAGGGTGTGCAGACACAGGCTGG - Intronic
1118862081 14:69672281-69672303 GAAGGTGAGAAGAGAGAGGAGGG + Intronic
1118979104 14:70701716-70701738 GGGGGTGAGAAGAAAGAGGAAGG + Intergenic
1119181109 14:72605829-72605851 GAGGTTGTGCAGAGTGATGATGG - Intergenic
1119685941 14:76631273-76631295 GAGAGCCTTCAGAGAGAGGATGG + Intergenic
1119931722 14:78553998-78554020 GAGTGTGTGGAGGGAGATGAAGG + Intronic
1120261042 14:82186351-82186373 GTGGGTGGGCAGTGAGGGGAGGG + Intergenic
1120568262 14:86085888-86085910 GAGGGGCTCCAGAAAGAGGAGGG + Intergenic
1120713718 14:87818527-87818549 GAAGATGTCAAGAGAGAGGATGG + Intergenic
1121066207 14:90968284-90968306 GAGGGAGGGAGGAGAGAGGAGGG - Intronic
1121306978 14:92912674-92912696 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1121539170 14:94712212-94712234 GGGTGAGTGCAGAGAGAGGAAGG - Intergenic
1122372035 14:101234217-101234239 GCTTGTTTGCAGAGAGAGGAAGG + Intergenic
1122616253 14:103020017-103020039 GAGGGTCTGAGGAAAGAGGACGG + Intronic
1122761744 14:104033733-104033755 GAGGGAGTGGAGAGAGAAGAGGG + Intronic
1122828526 14:104383954-104383976 GAGGGTCTGCAGGGGGAGGGTGG - Intergenic
1123072165 14:105647194-105647216 GAGGGAGGGCAGAGTGAGCAGGG - Intergenic
1123092172 14:105746711-105746733 GAGGGAGGGCAGAGTGAGCAGGG - Intergenic
1123097747 14:105774411-105774433 GAGGGAGGGCAGAGTGAGCAGGG - Intergenic
1202842375 14_GL000009v2_random:133789-133811 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1202911760 14_GL000194v1_random:124030-124052 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1202854589 14_GL000225v1_random:42750-42772 CGGCATGTGCAGAGAGAGGACGG - Intergenic
1202880854 14_KI270722v1_random:58600-58622 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123938832 15:25206953-25206975 GGGGGTCTGCAGAGAGGGGTAGG + Intergenic
1124147254 15:27139265-27139287 TGGGGGGTGCAGAGAGGGGATGG + Intronic
1124155245 15:27219568-27219590 GAGGGTGTGGACAGAGGGGTGGG - Intronic
1124252108 15:28113591-28113613 GCCGGTGAACAGAGAGAGGAGGG + Exonic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1124443492 15:29707462-29707484 GTGGATGTGCAGAGCTAGGAAGG + Intronic
1124577150 15:30919808-30919830 GAGGACGAGGAGAGAGAGGAGGG + Intronic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125181905 15:36887889-36887911 GAGGAGGTGAAGAGAAAGGACGG - Intergenic
1125193898 15:37024355-37024377 GAGACAGTGCAGAGAGAGAACGG - Intronic
1125281330 15:38044945-38044967 TAGGGACTGAAGAGAGAGGAAGG + Intergenic
1125349778 15:38754661-38754683 TAGGGTGTTGAGACAGAGGAGGG + Intergenic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125675958 15:41502760-41502782 GAGGGTGGGGTGGGAGAGGAGGG - Intronic
1125720269 15:41841991-41842013 GAGGAGGTGCAGAGGGAGGGAGG - Intronic
1125829408 15:42703301-42703323 GAGGGAGTGCAGAATGAGAACGG - Intronic
1125861375 15:43004363-43004385 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1126143518 15:45456245-45456267 GATGGTGTCCAGACAGAGGGAGG - Intergenic
1126244117 15:46483799-46483821 TATGGTGTGCAGAGGGAAGATGG + Intergenic
1126715440 15:51511552-51511574 GAGGATGTGGAGAAACAGGAAGG + Intronic
1126785748 15:52176807-52176829 GAGGGTTTTGAGAGAGAGGATGG - Intronic
1126799253 15:52285407-52285429 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1126799272 15:52285465-52285487 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1127117042 15:55738948-55738970 GAGGGAGGGGAGAGAGAGGAAGG + Intronic
1127343122 15:58066623-58066645 GTGGGTGTGCTGGGTGAGGAGGG - Intronic
1128157586 15:65401593-65401615 GTGGGAGTGCAGAGAGTGGGTGG + Intronic
1128296472 15:66524894-66524916 GCAGGGGTGCAGAGAGAGAAGGG - Intronic
1128542571 15:68545988-68546010 GGGGGAGGGCAGAGAGAGGTGGG - Intergenic
1128595213 15:68939604-68939626 GAAGGTGTGTGGAGAGAGGATGG + Intronic
1128647264 15:69386956-69386978 GTGGGTGGGGAGTGAGAGGAAGG - Intronic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129784449 15:78299728-78299750 GAGGGTGGGCGGAGAGAGGAGGG + Exonic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130565622 15:84992405-84992427 GAGGCTGACCAGAGATAGGACGG + Intronic
1130848792 15:87773389-87773411 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1130866990 15:87941685-87941707 GAGGGTGTGTGCAGAGAGAAGGG + Intronic
1130887844 15:88108971-88108993 GTGGATGGGCAGAGAGAGGGAGG - Intronic
1131301543 15:91203859-91203881 AAGGCTGTGCAGAGAGAGAGAGG - Intronic
1131307398 15:91257733-91257755 GAAGGGGTGCAGCCAGAGGAAGG - Intronic
1131316055 15:91338673-91338695 GAGAGTGAGGAGAGAGAGGGAGG + Intergenic
1131441203 15:92461023-92461045 GAAGGTTTGGAGAGAGAGAAAGG + Intronic
1131458206 15:92599588-92599610 GAGGGTGTGTAGAAATGGGATGG + Intergenic
1131598825 15:93826774-93826796 TAAGGTCTGCAAAGAGAGGAGGG + Intergenic
1131671270 15:94621955-94621977 GAGGCAAGGCAGAGAGAGGAGGG + Intergenic
1131676069 15:94671985-94672007 GTGGGAGGGAAGAGAGAGGAGGG + Intergenic
1131700312 15:94928366-94928388 GAAGCTGTGCAGAGAGAAGATGG + Intergenic
1131710561 15:95050730-95050752 GAGGGTGGGGAGTGAGAGTAGGG - Intergenic
1131830350 15:96351007-96351029 AAGTGTGTGCAGGGACAGGAGGG + Intergenic
1131956455 15:97741047-97741069 GGGGCTGTGCAGAGAGAGAAGGG - Intergenic
1131957740 15:97755593-97755615 GTGGGTGGGAAGAGATAGGAAGG - Intergenic
1131969909 15:97881595-97881617 GATGGGGTGGAGAGTGAGGATGG - Intergenic
1132012917 15:98291912-98291934 GAAGGTGGAAAGAGAGAGGAGGG + Intergenic
1132221625 15:100109474-100109496 GAGGGTGTGAAGGGAGGGGGAGG + Intronic
1132325355 15:100964245-100964267 GGGGGTGTGCAGAGGAGGGAGGG - Intronic
1132340846 15:101077740-101077762 GGCGGTGTGGAGAGAGAGAATGG - Intronic
1132358197 15:101189269-101189291 GAGAGGGTGCTGAGAGAGCACGG - Intronic
1132451319 15:101970062-101970084 GGGAGTGTGCAGAGACTGGAGGG + Intergenic
1132500195 16:281588-281610 GAGAGCGAGCAGAGAGAGCAGGG - Intronic
1132664758 16:1076291-1076313 CAGGGTGTGGGGAGAGAGGGAGG - Intergenic
1132688196 16:1171045-1171067 AAGGGTGTGCAGGAAGAGGGAGG - Intronic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132989898 16:2787165-2787187 GAGGGGGTGAGGATAGAGGAGGG - Intronic
1133076462 16:3284167-3284189 GAGGATATGCAGAGAGAGCTTGG + Exonic
1133226669 16:4344209-4344231 GAGGGCGTTCCGTGAGAGGAGGG + Intronic
1133226675 16:4344227-4344249 GAGGGGGTTCCGTGAGAGGAGGG + Intronic
1133226681 16:4344245-4344267 GAGGGGGTTCCGTGAGAGGAGGG + Intronic
1133226687 16:4344263-4344285 GAGGGGGTTCTGTGAGAGGAGGG + Intronic
1133226697 16:4344301-4344323 GAGGGGGTTCTGTGAGAGGAGGG + Intronic
1133226702 16:4344319-4344341 GAGGGGGTTCCGTGAGAGGAGGG + Intronic
1133226722 16:4344397-4344419 GAGGGGGTTCTGTGAGAGGAGGG + Intronic
1133226740 16:4344469-4344491 GAGGGGGTTCTGTGAGAGGAGGG + Intronic
1133226745 16:4344487-4344509 GAGGGGGTTCTGTGAGAGGAGGG + Intronic
1133226758 16:4344541-4344563 GAGGGGGTTCCGTGAGAGGAGGG + Intronic
1133226764 16:4344559-4344581 GAGGGGGTTCTGTGAGAGGAGGG + Intronic
1133226769 16:4344577-4344599 GAGGGGGTTCCGTGAGAGGAGGG + Intronic
1133226785 16:4344628-4344650 GAGGGGGTTCCGTGAGAGGAGGG + Intronic
1133226791 16:4344646-4344668 GAGGGGGTTCCGTGAGAGGAGGG + Intronic
1133226797 16:4344664-4344686 GAGGGGGTTCTGTGAGAGGAGGG + Intronic
1133226813 16:4344718-4344740 GAGGGGGTTCCGTGAGAGGAGGG + Intronic
1133226819 16:4344736-4344758 GAGGGGGTTCTGTGAGAGGAGGG + Intronic
1133226824 16:4344754-4344776 GAGGGGGTTCCGTGAGAGGAGGG + Intronic
1133226830 16:4344772-4344794 GAGGGGGTTCTGTGAGAGGAGGG + Intronic
1133226843 16:4344826-4344848 GAGGGGGTTCTGTGAGAGGAGGG + Intronic
1133226848 16:4344844-4344866 GAGGGGGTTCCGTGAGAGGAGGG + Intronic
1134017491 16:10899224-10899246 GTGGGTTTGGAGAGGGAGGAAGG - Intronic
1134692071 16:16197631-16197653 GAAGGGGTGCAGGAAGAGGAGGG + Intronic
1134913258 16:18048317-18048339 CAGGCTTTGCAGAGAGAGGGCGG + Intergenic
1135049999 16:19185090-19185112 GAGGGAGTGAAGAGAGAAGCGGG - Intronic
1135147425 16:19974758-19974780 GAGGGAGGGCAGGCAGAGGAAGG + Intergenic
1135639884 16:24110133-24110155 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1135639887 16:24110142-24110164 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
1135970631 16:27069622-27069644 GAGGGTGGGGAGTGGGAGGAGGG - Intergenic
1136338561 16:29627300-29627322 GCGGGTGTGCAGTGAGATGTCGG + Intergenic
1136381857 16:29899629-29899651 GAGGAAGTGCAGATGGAGGAGGG + Intergenic
1136406936 16:30053513-30053535 GAGGGGGCCCAGAGAGGGGAAGG - Intronic
1137249383 16:46731139-46731161 GAGGGTGAGAGGAGAGAGGGTGG - Intronic
1137306716 16:47207767-47207789 GAGGGTGGGGAGAGAGAAAATGG - Intronic
1137460975 16:48662975-48662997 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1137467599 16:48724817-48724839 GAGGATGTGAAGAGATAGGAAGG + Intergenic
1137824535 16:51479880-51479902 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1137826849 16:51505249-51505271 GACTGAGTGCAGTGAGAGGATGG - Intergenic
1137947557 16:52749448-52749470 GAGGGAGTATAGAGAGAAGAAGG + Intergenic
1138028041 16:53538518-53538540 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138028044 16:53538527-53538549 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138028047 16:53538536-53538558 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138028050 16:53538545-53538567 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1138155735 16:54701409-54701431 GTGAGTGTTCAGAGAGAGGTAGG - Intergenic
1138389669 16:56661303-56661325 GATGGTGCGCAGAGGGAGGAAGG - Intronic
1138490244 16:57372398-57372420 GAGGGTGGGAGGGGAGAGGAAGG - Intergenic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1139029147 16:62858355-62858377 AGGGGGGGGCAGAGAGAGGATGG - Intergenic
1139504480 16:67392199-67392221 GTGGGTGTGAAGATGGAGGATGG - Intronic
1139558228 16:67726254-67726276 GGTGGTGGGCAGAGAAAGGAAGG + Exonic
1139760380 16:69180190-69180212 GAGGGAGGGAAGAGAGAGGAAGG - Intronic
1139834692 16:69828838-69828860 GGTGGTTTGCATAGAGAGGAAGG - Intronic
1139853440 16:69963749-69963771 GAAGTTGGGCAGAGAGAGGCAGG + Exonic
1139882411 16:70186658-70186680 GAAGTTGGGCAGAGAGAGGCAGG + Exonic
1140125184 16:72112501-72112523 GAGGCTGTCCCCAGAGAGGATGG + Exonic
1140370099 16:74408846-74408868 GAAGTTGGGCAGAGAGAGGCAGG - Exonic
1140453440 16:75090041-75090063 GAGGCTGTGGAAGGAGAGGAGGG - Intronic
1140859320 16:79005498-79005520 TAGAGTTTTCAGAGAGAGGATGG - Intronic
1140887640 16:79258897-79258919 GAGGGAGGGTAGAGAGAAGATGG + Intergenic
1140993903 16:80242524-80242546 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1140993906 16:80242533-80242555 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1140993909 16:80242542-80242564 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1141492259 16:84382126-84382148 GGGGGTGTGGGGAGAGGGGAGGG - Intronic
1142141886 16:88476222-88476244 GAGGCTGTGCAGAGGGATGGAGG - Intronic
1142252876 16:89000761-89000783 GAGGGGGCACAGACAGAGGAGGG - Intergenic
1142601877 17:1057106-1057128 GAGGGAGAGCCGAGAGAGAAGGG + Intronic
1142606028 17:1081486-1081508 CCCAGTGTGCAGAGAGAGGATGG - Intronic
1142913372 17:3113610-3113632 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1142913375 17:3113619-3113641 GAGGGAGAGGAGGGAGAGGAGGG + Intergenic
1142924145 17:3218281-3218303 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1143106554 17:4533224-4533246 GAGGCTGTGGGGACAGAGGATGG - Exonic
1143297662 17:5883449-5883471 GAGGATGGGAAGGGAGAGGAAGG - Intronic
1143314494 17:6022080-6022102 GAGGGTGTGCAAAGTGAGATGGG - Intronic
1143545237 17:7591540-7591562 GGGGGTGTTCAGAGAGAGATTGG + Exonic
1143648085 17:8245149-8245171 GAGGGTGGGAAGAGAGAGATTGG + Intronic
1143839005 17:9716581-9716603 GAGGGGGTGCAGGGTGAGGTGGG + Intronic
1144583748 17:16475314-16475336 GTGTGTGTGGAGAGAGAGGAAGG + Intronic
1144784262 17:17823251-17823273 GAGGGTTTGGAGGGAGAGGGTGG - Intronic
1145037702 17:19552816-19552838 GAGGGGATGCAGTGAGATGATGG + Intronic
1145133201 17:20376932-20376954 GAGGGAGGGGAGGGAGAGGAGGG - Intergenic
1145270101 17:21400292-21400314 CAGGGTGTGAGGAGACAGGAGGG - Intronic
1145308323 17:21687743-21687765 CAGGGTGTGAGGAGACAGGAGGG - Intergenic
1145721128 17:27074079-27074101 GTGGTGGTGCAGGGAGAGGAGGG - Intergenic
1145759445 17:27417962-27417984 GAGGCAGGGCAGAGAGCGGACGG - Intergenic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1146474548 17:33152568-33152590 GAAGGTGTGCACAGGGAGGTGGG + Intronic
1146927564 17:36755475-36755497 GAGGGGGTGCAGAGGGAGTGGGG + Intergenic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147159582 17:38562430-38562452 GAGGGAGGGCAGAGAGCAGAAGG - Intronic
1147177244 17:38663576-38663598 GAGAGTGGGGAGAGAGAGGGTGG - Intergenic
1147278244 17:39336956-39336978 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1147376143 17:40023437-40023459 TAGGGTGGGGAGGGAGAGGAGGG + Intronic
1147379020 17:40041421-40041443 GAGATTGTGCAGAGACAGCAGGG - Intronic
1147417690 17:40305367-40305389 GAGGGGGCGCAGAGAGAATAAGG - Intergenic
1147553298 17:41460339-41460361 GAGGCTGGGCAGAGAAAGCACGG - Intronic
1147564619 17:41528535-41528557 CAGGGTCTGCAGAGAGAGAGTGG - Intergenic
1147817600 17:43221323-43221345 GAGGGTGGAAAGAGAGTGGAAGG - Intergenic
1147907360 17:43832034-43832056 CAGGCTGTGGACAGAGAGGATGG + Intronic
1148063625 17:44853177-44853199 CGGGGTTTCCAGAGAGAGGAGGG + Intronic
1148562008 17:48611682-48611704 GAGGGTGGGGAGAGAAAGGAAGG + Intronic
1148675815 17:49444270-49444292 GCGGGTGGGCAGAGAGGGGTGGG + Intronic
1148686173 17:49502396-49502418 GGAAGTGTGCAGAGGGAGGAGGG + Intronic
1148860536 17:50602214-50602236 GGGTGTGAGCACAGAGAGGAGGG - Intronic
1149139427 17:53412550-53412572 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1149176305 17:53876082-53876104 TAGGGGGTGCAGGGGGAGGAAGG - Intergenic
1149240633 17:54644712-54644734 GAGGATGTGAAGAAATAGGAAGG + Intergenic
1149519900 17:57310778-57310800 GATGCTGTGCAGATAGAGGTTGG + Intronic
1149984921 17:61340073-61340095 GAGTGTGTTCAAAGAGAGAAAGG + Intronic
1150119246 17:62585838-62585860 GATGGTGTCCAGAAAGAGAATGG + Intronic
1150456120 17:65308206-65308228 GGGGGTGGGCAGGGAGAGGGAGG + Intergenic
1150506246 17:65701834-65701856 GAGGGAGAACAGAGAGAGTAGGG - Intronic
1151370911 17:73645489-73645511 AAGGCTGGGCAGAGAGCGGAGGG - Intergenic
1151431140 17:74064066-74064088 GAGGGTGGGAAGGGAGAGGAGGG + Intergenic
1151765200 17:76130147-76130169 GTGGGGGTGCAGCGTGAGGAAGG + Intergenic
1151787700 17:76283307-76283329 GAGTGTGTTCAGAGAAAGGCAGG + Intronic
1152321610 17:79611110-79611132 GAAGGAGGGCGGAGAGAGGAGGG - Intergenic
1152485205 17:80586600-80586622 GAGGGGGAGGAGAGAGGGGAGGG - Intronic
1152742008 17:82022574-82022596 GAGGGTCTGCAGAAACAGGCAGG - Intronic
1152813013 17:82391096-82391118 GAGGAGGTGCTGAGGGAGGAGGG + Intronic
1152863556 17:82709491-82709513 TAGGGTGTGCAGAGAGGGACCGG - Intergenic
1152939533 17:83160969-83160991 GGGGCTGAGCAGAGACAGGAGGG + Intergenic
1153072678 18:1123913-1123935 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1153125124 18:1782459-1782481 TGGGGTGGGGAGAGAGAGGAGGG - Intergenic
1153367409 18:4273015-4273037 AAGGGCCTTCAGAGAGAGGAAGG + Intronic
1153760035 18:8321735-8321757 GTGGCGGTGCAGGGAGAGGAGGG + Intronic
1153777121 18:8463944-8463966 GAGGGTTGGCAGGGAGAGCAAGG + Intergenic
1153787038 18:8544281-8544303 GGGTGTTTGCAGAGAGAGGTGGG + Intergenic
1153987790 18:10368591-10368613 GAGGGAGAGCAGAGAGAGGGAGG + Intergenic
1154126649 18:11698013-11698035 GAGGACGTGCAGAGTGAGAAAGG + Intronic
1154465614 18:14641105-14641127 GAGGGTGGCGAGAGGGAGGAGGG - Intergenic
1156087203 18:33420281-33420303 GAGGGTGGGGTGAGGGAGGAAGG + Intronic
1156463222 18:37333317-37333339 GAGGGAGTGGAGGGGGAGGAGGG - Intronic
1156493161 18:37508332-37508354 GAGAGCGTGCAGAGGCAGGAGGG + Intronic
1156688830 18:39681843-39681865 GTGGGTGGGCAGGCAGAGGAAGG + Intergenic
1156966801 18:43104264-43104286 GAGGCTGGGAAGAGAGAGGGAGG + Intronic
1157454035 18:47810333-47810355 GTGAGTGTGCAGTGGGAGGAGGG - Exonic
1157567392 18:48688911-48688933 GAGTGTGTGCAGAGACAGAGAGG - Intronic
1157609824 18:48949463-48949485 AAGGGGGTGCAGAGGGAGGTGGG - Intronic
1157624256 18:49036728-49036750 GTGTGTGTGTAGAGACAGGAGGG + Intergenic
1158072684 18:53491940-53491962 GAGGATGTGGAGACATAGGAAGG - Intronic
1158393955 18:57065176-57065198 GGTGGTGTGGAGAGAGAGAATGG + Intergenic
1158549358 18:58422085-58422107 GAAGGTGTGCAAAGCGAGGCGGG + Intergenic
1158559711 18:58503843-58503865 GAGGGAGGGGAGGGAGAGGAAGG - Intronic
1158708602 18:59817176-59817198 GAGTCCGTGCAGACAGAGGACGG + Intergenic
1158931831 18:62330481-62330503 AGGGGTGTGGGGAGAGAGGAAGG + Intronic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159489896 18:69118693-69118715 GAGGGTGGACAGTGAGAGGAGGG - Intergenic
1159770736 18:72543372-72543394 GAGGAGGTGGAGAGAGAGAAGGG - Intronic
1159913895 18:74172060-74172082 GGGGGACAGCAGAGAGAGGAGGG - Intergenic
1160399942 18:78602734-78602756 CAGGGCGTGCACAGAGAGGCAGG + Intergenic
1160633944 19:62485-62507 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
1160758598 19:771550-771572 GAGGGAGAGTAGACAGAGGAGGG - Intergenic
1160770487 19:828724-828746 GAGGGGGCCCAGAGAAAGGAAGG + Intronic
1160770497 19:828757-828779 GAGGAGGTGCAGAGAAGGGAAGG + Intronic
1160770518 19:828823-828845 GAGGAGGTGCAGAGAAGGGAAGG + Intronic
1160770532 19:828889-828911 GAGGAGGTGCAGAGAAGGGAAGG + Intronic
1160770550 19:828955-828977 GAGGAGGTGCAGAGAAGGGAAGG + Intronic
1160770609 19:829120-829142 GAGGAGGTGCAGAGAAGGGAAGG + Intronic
1160872082 19:1282224-1282246 GAGGGTGTGAAGGGGAAGGAGGG + Intergenic
1161088719 19:2347249-2347271 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088729 19:2347384-2347406 GCGTGTGTGGAGAGAGAGAACGG - Intronic
1161088732 19:2347425-2347447 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088735 19:2347468-2347490 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088742 19:2347562-2347584 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088749 19:2347656-2347678 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088759 19:2347791-2347813 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088765 19:2347875-2347897 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088783 19:2348110-2348132 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088785 19:2348153-2348175 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088790 19:2348237-2348259 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088808 19:2348472-2348494 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088817 19:2348607-2348629 GTGTGTGTGGAGAGAGAGAATGG - Intronic
1161088819 19:2348654-2348676 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088821 19:2348697-2348719 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088823 19:2348740-2348762 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088833 19:2348879-2348901 GTGTGTGTGGAGAGAGAGAATGG - Intronic
1161088836 19:2348973-2348995 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088852 19:2349202-2349224 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088855 19:2349247-2349269 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088859 19:2349333-2349355 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088862 19:2349378-2349400 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088864 19:2349423-2349445 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088866 19:2349466-2349488 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088869 19:2349511-2349533 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088872 19:2349556-2349578 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088874 19:2349601-2349623 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088876 19:2349644-2349666 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088879 19:2349689-2349711 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088883 19:2349775-2349797 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088886 19:2349865-2349887 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088890 19:2349910-2349932 GTGTGTGTGGAGAGAGAGAATGG - Intronic
1161088895 19:2350045-2350067 GAGTGTGTGGAGAGAGAGAACGG - Intronic
1161088898 19:2350135-2350157 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088900 19:2350182-2350204 GAGTGTGTGTGGAGAGAGAACGG - Intronic
1161088905 19:2350270-2350292 GAGTGTGTGGAGAGAGAGAACGG - Intronic
1161088909 19:2350362-2350384 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161088913 19:2350452-2350474 GTGTGTGTGGAGAGAGAGAACGG - Intronic
1161093633 19:2376193-2376215 GTGGCTGTGAAGGGAGAGGAAGG - Intergenic
1161234519 19:3191230-3191252 GACGTTTTGCTGAGAGAGGAGGG + Intronic
1161258889 19:3324701-3324723 AAGGGAGGGCAGGGAGAGGATGG - Intergenic
1161326908 19:3668437-3668459 GTGGCTGTGAAGAGGGAGGAAGG + Intronic
1161374673 19:3933369-3933391 GAGGGAGTGGAGAGAGGGCAGGG + Intronic
1161498012 19:4598012-4598034 GAGAGGGGGCCGAGAGAGGACGG + Intergenic
1161498357 19:4599231-4599253 GAGGGCCTGCAGAGGAAGGAAGG - Intergenic
1161509636 19:4663297-4663319 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509654 19:4663384-4663406 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509665 19:4663431-4663453 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509686 19:4663517-4663539 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161509756 19:4663781-4663803 GAGGCTGTGTAGAATGAGGATGG - Intronic
1161643367 19:5437303-5437325 GAGGGTAGGCAGAGGCAGGAGGG + Intergenic
1161718373 19:5890116-5890138 GAGGGAGGGGAGGGAGAGGAGGG + Intronic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1161849573 19:6731525-6731547 GAGGGTGGGCACAGAGAGGGCGG + Intronic
1161873327 19:6887521-6887543 GAAGGTGTGCGAAGAGGGGAAGG - Intergenic
1161964520 19:7540889-7540911 GAGGGCGTGAAGAGAGACAAGGG - Intronic
1162080482 19:8214939-8214961 GAGGGGGAGGAGAGGGAGGAGGG + Intronic
1162127449 19:8507048-8507070 GAGAGGCTGCAGGGAGAGGAGGG - Intergenic
1162186337 19:8907726-8907748 GGGGCTGGGCAGAGTGAGGAGGG + Intronic
1162470631 19:10870697-10870719 GAGGAGGGGCTGAGAGAGGAGGG + Intergenic
1162795143 19:13083135-13083157 GAGCTTGTCCAGAGAGAGGTGGG - Intronic
1162854789 19:13460050-13460072 GCGGGTGAGCAGAGGGAGGGGGG - Intronic
1163005991 19:14397003-14397025 GAGTGGGTGCAGTGAGTGGAGGG + Intronic
1163061755 19:14766433-14766455 GAGTGGGTGCAGTGAGTGGAGGG - Intronic
1163359517 19:16837038-16837060 GGGAGAGGGCAGAGAGAGGATGG + Intronic
1163502594 19:17685940-17685962 GATGGTGCCCAGAGAGGGGAGGG - Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163611526 19:18304383-18304405 GAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1164472357 19:28546821-28546843 GGGTGTGTGCCGTGAGAGGAAGG - Intergenic
1164605066 19:29591954-29591976 AAGGGTGTGCAGGGAGTGGCTGG + Intergenic
1164683201 19:30149708-30149730 GGTGGTGGGCAGGGAGAGGAGGG - Intergenic
1164962777 19:32449740-32449762 TAGTGTGTACAGTGAGAGGAAGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165382133 19:35489001-35489023 GCGGATGTGCAGGGTGAGGAGGG + Intronic
1165580597 19:36859865-36859887 GTGTGTGTGCAGAGAGAGAGAGG - Intronic
1165767315 19:38359604-38359626 GGGGGTGGGCAGAGAGGGAACGG - Intronic
1165800272 19:38545267-38545289 GAGGGATTGTAAAGAGAGGAGGG + Intronic
1165808695 19:38597288-38597310 ACGGGTGTGCAGAGAGTGGGCGG - Intronic
1165902167 19:39174080-39174102 GGAGGAGTGCAGGGAGAGGAGGG - Intronic
1165945830 19:39441589-39441611 GAGGCTGGGTAGAGAGAGGGAGG + Intronic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166147827 19:40849598-40849620 GAGGTGGGGCAGAGAGAGGCAGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151962 19:40881369-40881391 GAGGTGGGGCAGAGAGAGGCAGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1166465337 19:43026546-43026568 GAGGCAGGGCTGAGAGAGGAGGG - Intronic
1166657455 19:44622772-44622794 CAAGGTGGGCATAGAGAGGAGGG - Intronic
1166668169 19:44694088-44694110 AATGAGGTGCAGAGAGAGGAAGG + Intergenic
1166832572 19:45647543-45647565 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1166832575 19:45647552-45647574 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1166851133 19:45761906-45761928 GAGAGGGTGGTGAGAGAGGAAGG - Intronic
1166935489 19:46329991-46330013 GAGAGAGTGAAGAGAGAGGAAGG + Intronic
1167011847 19:46813741-46813763 GAGGGAGAGGAGGGAGAGGAAGG - Intergenic
1167063641 19:47167686-47167708 GAGGGTATGGAGAGAGAGGGAGG + Intronic
1167295560 19:48646902-48646924 GAGGGGGAGGAGGGAGAGGAGGG + Intergenic
1167521758 19:49959647-49959669 GTGGGGGTGGAGAGAGAGAATGG + Intronic
1167523625 19:49971075-49971097 GTGGGGGTGGAGAGAGAGAATGG - Intergenic
1167529617 19:50007202-50007224 GCCAGTGTGCAGAGAGAGGATGG - Intronic
1167602046 19:50459957-50459979 GAGGGGGTGTGGAGAGGGGAGGG + Intronic
1167615654 19:50531449-50531471 GGGGGTGTGAAGGGAGATGAAGG + Intronic
1167618643 19:50549505-50549527 CAGGGTGGGCAGTGACAGGAGGG - Intronic
1167650784 19:50727522-50727544 GAGAGAGTACAGAGAGATGAAGG - Intergenic
1167764754 19:51474392-51474414 GAGGGTGGACAGTAAGAGGAGGG - Intergenic
1167822032 19:51937048-51937070 TGGTGTGTGCAGAGAGAGCATGG + Intronic
1168252082 19:55147028-55147050 ACGGGTGTGGGGAGAGAGGAGGG + Intronic
1168493751 19:56833410-56833432 GTCGGTCTGCAGAGAGAGGCAGG - Intronic
1168559448 19:57370859-57370881 GAGGGTGTAGAGATTGAGGAAGG + Intronic
1202656463 1_KI270708v1_random:27707-27729 GAGAGTGTGGAGAAATAGGAAGG + Intergenic
1202676819 1_KI270711v1_random:14728-14750 TAGGGTGTGGGGAGGGAGGAGGG - Intergenic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925001992 2:410369-410391 GATGGTGTGGACAGTGAGGATGG - Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925188794 2:1866851-1866873 GAGGGAGGGCAGAGAGAGATGGG + Intronic
925311889 2:2890752-2890774 GAGAGTGTGAAGAGAGAGATGGG + Intergenic
925363238 2:3294372-3294394 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363290 2:3294605-3294627 GGGTGTGTGTGGAGAGAGGATGG - Intronic
925363306 2:3294673-3294695 GAGGGTGTGTGTAGAGAGGACGG - Intronic
925363313 2:3294704-3294726 GAGGGTGTGTGTAGAGAGGATGG - Intronic
925363325 2:3294769-3294791 GTGTGTATGTAGAGAGAGGATGG - Intronic
925363332 2:3294804-3294826 GAGGGTGTGTGGAGAGAGGATGG - Intronic
925363340 2:3294835-3294857 GAGGGTATGTGGAGAGAGGATGG - Intronic
925363354 2:3294900-3294922 GTGTGTGTGCAGGGAGAGAATGG - Intronic
925363421 2:3295255-3295277 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363429 2:3295288-3295310 GGGTGTGTGTGGAGAGAGGACGG - Intronic
925363443 2:3295356-3295378 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363463 2:3295455-3295477 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363484 2:3295554-3295576 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363491 2:3295588-3295610 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363510 2:3295688-3295710 GAGGGTGTGCAGAGAGAGGAGGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363538 2:3295822-3295844 GTGTGTGTGCAGGGAGAGGATGG - Intronic
925363547 2:3295859-3295881 GGGTGTGTGCAGAGAGAGGATGG - Intronic
925363554 2:3295892-3295914 GAGGGTGTGTAAAGAGAGAATGG - Intronic
925363560 2:3295923-3295945 GTGTGTGTGCAAGGAGAGGATGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363575 2:3295995-3296017 GAGGGTGTGTAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363609 2:3296163-3296185 GTATGTGTGCAGGGAGAGGAGGG - Intronic
925363649 2:3296338-3296360 GTGTGTGTGTAGAGAGAGAACGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363670 2:3296447-3296469 GTGTGTGTGTGGAGAGAGGATGG - Intronic
925363678 2:3296482-3296504 GAGGGTGTGTGTGGAGAGGATGG - Intronic
925507356 2:4583369-4583391 GAGTGTGGTCAGAGAGAGAAAGG + Intergenic
926052672 2:9754723-9754745 GAGGGTGGGCAGGGGCAGGAGGG + Intergenic
926321170 2:11749260-11749282 GAGGGTCTGGAGAGAGAGAGGGG + Intronic
926425225 2:12733859-12733881 GAGCCTGTGCTGAGAGTGGATGG + Intronic
926693919 2:15757393-15757415 GATGGTATGCAGAGAAAAGAAGG + Intergenic
927114248 2:19885909-19885931 GAGAGTGAGGGGAGAGAGGAAGG - Intergenic
927125293 2:20007875-20007897 GAGGGTGTGCAAACAGGGGTTGG - Intronic
927510444 2:23641023-23641045 GAGGATGGGGAGACAGAGGAAGG - Intronic
927702236 2:25275927-25275949 GAGGGGGTGCGGAAGGAGGAGGG + Intronic
928409248 2:31041666-31041688 GAAGGTGAGCAGGGAGGGGAAGG + Intronic
928488203 2:31754194-31754216 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929453613 2:42051700-42051722 GAGGGGGTGGAGAGAGAAGAGGG + Intronic
929552755 2:42904829-42904851 GAGGCTGTGCAGCGTGAGGGAGG + Intergenic
929990720 2:46783931-46783953 GAAGCTGTGTAGTGAGAGGATGG + Intergenic
930030744 2:47056716-47056738 GAGGGGGTGGAGAGAGATGGAGG + Intronic
930086362 2:47500253-47500275 GAGGCTCTGCTGAGTGAGGACGG + Intronic
930307382 2:49692481-49692503 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
930608407 2:53515824-53515846 GAGGGTGGGGAGAGATAGGCAGG - Intergenic
930661037 2:54053422-54053444 GTGGGTGTGCAGAGTGAGTTGGG - Intronic
930793271 2:55357384-55357406 GAGAGAGAGGAGAGAGAGGAGGG - Intronic
931618947 2:64190565-64190587 GAGGGTGTGTCGGGAGAGGGAGG - Intergenic
932429443 2:71665351-71665373 GAGGGTCTGATGAGAGAGGGAGG - Intronic
932804012 2:74767600-74767622 GAGGGTGTGCAAAGAGACAGGGG - Intergenic
933012183 2:77080346-77080368 GAGAGTGTGCAGACTGAGAAAGG - Intronic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933628830 2:84633427-84633449 AAGGGAGAACAGAGAGAGGAAGG + Intronic
933629946 2:84644583-84644605 GAGGGTGGGGAGTGGGAGGAGGG - Intronic
933666353 2:84968339-84968361 AGGAGGGTGCAGAGAGAGGAAGG + Intergenic
933713480 2:85344195-85344217 GAGGGGGTGGAGGGAGAGGCCGG - Intronic
934047330 2:88183576-88183598 GAGGGAGGAAAGAGAGAGGAAGG - Intronic
934511747 2:94950060-94950082 GAGGATGTGGAGAAACAGGAAGG - Intergenic
934707996 2:96498101-96498123 GAGGTGCGGCAGAGAGAGGAAGG - Exonic
934851749 2:97706337-97706359 GAGTGTGTCCTGAGAGGGGATGG + Intergenic
934897211 2:98129251-98129273 GTGTGTGTGGAGAGAGAGGGAGG + Intronic
934956259 2:98622848-98622870 GAGGGAGTTAAGAGAGAGAAAGG + Exonic
935091759 2:99901439-99901461 TCGGCTGTGAAGAGAGAGGAGGG - Intronic
935147439 2:100405465-100405487 AAGGTGGGGCAGAGAGAGGATGG + Intronic
935185305 2:100726284-100726306 GGGGATGTGGAGTGAGAGGAAGG + Intergenic
935468672 2:103430638-103430660 GAGAGTGTGCTGAGAATGGAGGG - Intergenic
935617568 2:105102191-105102213 GTGGGTGTGCTGAGATGGGATGG + Intergenic
936252545 2:110877764-110877786 GAGGGTGAAGACAGAGAGGAAGG + Intronic
936459958 2:112706332-112706354 AAGGGGGTGGAGAGAGGGGAAGG - Intergenic
936567534 2:113592543-113592565 GGGAGTGTGCAGAGACTGGAGGG + Intergenic
936577341 2:113667772-113667794 GAAGGTGAGCAGAGAGAGGGTGG + Intergenic
936656421 2:114493284-114493306 GATGGTGGGCAGAGAGAGAAAGG + Intronic
936669512 2:114640604-114640626 GAGGGAGGACAGAGACAGGAGGG - Intronic
937033572 2:118762157-118762179 GAGGTTGTGAAGAGAGAAAATGG - Intergenic
937047547 2:118859613-118859635 GCAGGTGTGCAGAGAGAAGCGGG + Intergenic
937059658 2:118971640-118971662 GAGGCTGTGGAGACAGGGGAAGG - Intronic
937320943 2:120960376-120960398 GAGGGCGAGCAGGGAGAGGTGGG + Intronic
937378157 2:121352072-121352094 GAGGGTGTGGAGACCCAGGAAGG + Intronic
938115590 2:128601348-128601370 GAGGGTGTGCACACACTGGACGG - Intergenic
938990138 2:136619416-136619438 GAGGGTGAAGAGTGAGAGGAGGG - Intergenic
939225159 2:139354832-139354854 GAGGGCAGGCAGAGAGTGGAGGG + Intergenic
939417761 2:141923478-141923500 GTGTGTGTGTAGAGAGAGGGAGG + Intronic
939930305 2:148226254-148226276 GTGGGTGGGGAGAGAGGGGAGGG - Intronic
939991008 2:148876439-148876461 GAGGGTCTGCAGACATGGGAGGG - Intronic
940720270 2:157274458-157274480 GAGGATGTGGAGAAATAGGAAGG - Intronic
942286173 2:174419231-174419253 TAGGGTTTTGAGAGAGAGGAAGG + Intronic
942349989 2:175042234-175042256 GTGGGTGTGGAGTGAGGGGAGGG - Intergenic
942499872 2:176578288-176578310 GTGGGTGGGCGGAGAGGGGAGGG - Intergenic
942990510 2:182195370-182195392 GAAGGTGTATAGAGACAGGAAGG + Intronic
943370588 2:187010996-187011018 GGGTGTGTGCAGAGAGGGGAAGG - Intergenic
943727341 2:191265966-191265988 GAGGGGGTGGAGAGGGAGGCAGG + Intronic
943890031 2:193275327-193275349 GAGGGTGTGGAGGGAGAGCTGGG - Intergenic
944300432 2:198118377-198118399 GAGGGAGAGGAGAGAGAGAAAGG + Intronic
944851272 2:203721931-203721953 GAGGGAAGGGAGAGAGAGGAAGG - Intronic
945761050 2:213915749-213915771 GAGGATGTGAAGAAATAGGAAGG - Intronic
945807876 2:214512403-214512425 GAGGGTGGGGAGTGGGAGGAGGG + Intronic
945999092 2:216465857-216465879 GAGGGTGTGGAGAGGTAGGTGGG - Intronic
946135945 2:217646987-217647009 TAAGGAATGCAGAGAGAGGAAGG - Intronic
946303200 2:218838117-218838139 GAAGGAGAGTAGAGAGAGGATGG + Intergenic
946455819 2:219825205-219825227 GAGGGAGTGCAGAGACAGTGAGG + Intergenic
946864803 2:224033176-224033198 GATGGTTTGCAAAGAGAAGATGG + Intronic
947053578 2:226075165-226075187 GAGGGTTGGTGGAGAGAGGATGG - Intergenic
947116305 2:226774925-226774947 GGGGTTGGGGAGAGAGAGGAAGG + Intronic
948027604 2:234790360-234790382 GAAGGTGAGGAGAGGGAGGAAGG + Intergenic
948355284 2:237372732-237372754 TAGGGTGGGCTCAGAGAGGATGG + Intronic
948618797 2:239219957-239219979 GGAGGTGTGCATACAGAGGATGG + Intronic
948629671 2:239294048-239294070 GAGGGTGGGCTGGGAGACGATGG - Intronic
948662451 2:239515672-239515694 GTGGGTGTGCAGAATGAGCAGGG - Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948802717 2:240440145-240440167 GAGGGTGTCCGGGGAGAGGGGGG - Intronic
948968434 2:241403809-241403831 TAGGCTGTGCAGAGAGAGATGGG - Exonic
948994422 2:241571263-241571285 GGGGGCGTGGAGACAGAGGAAGG - Intronic
1168767043 20:388699-388721 GAGGATGTGCAGAAAGGGGCAGG + Intronic
1169204180 20:3730859-3730881 GAGGCTGAGCAGAGCCAGGAGGG - Intergenic
1169472933 20:5903972-5903994 GAGGATGAGCACAGAGAGAAGGG + Intergenic
1169547869 20:6669334-6669356 GAGGCTATGCAGAGAGAAGAGGG - Intergenic
1170265288 20:14460354-14460376 GAGGATGTGGAGAAATAGGAAGG - Intronic
1170270081 20:14517050-14517072 GAGGATGTGGAGAAATAGGAAGG + Intronic
1170288363 20:14737582-14737604 GAGGATGTGGAGAAATAGGAAGG - Intronic
1170291006 20:14768267-14768289 GAGGATGTGGAGAAATAGGAAGG - Intronic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1171174656 20:23042446-23042468 GAGGGGGAGCAGAGAGCAGAGGG - Intergenic
1171191136 20:23160643-23160665 CAGGGTGGGCGGAGACAGGAAGG - Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171266996 20:23779610-23779632 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1171276716 20:23862385-23862407 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1171370924 20:24661493-24661515 GAGGGAGGGAAGAGGGAGGAAGG + Intronic
1171431697 20:25086928-25086950 GAGGGTTTGAAGAGAGATGCAGG - Intergenic
1171571850 20:26259868-26259890 GAGGGTGTGGAGCAAGAGGAGGG - Intergenic
1171973474 20:31578933-31578955 GGAGGTGTGGAGAGAGAGGCAGG - Intergenic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1172284273 20:33730247-33730269 TAGGGAGTGCATAGAGGGGAGGG - Intergenic
1172299282 20:33837519-33837541 GAGGAATTTCAGAGAGAGGAGGG + Intronic
1172321529 20:33998819-33998841 GAGTGTGTGCAGAAAAAAGATGG + Intronic
1172648575 20:36487104-36487126 GAGGCTCTGCAGATGGAGGAGGG + Intronic
1172805822 20:37610925-37610947 GAGGGTGGGCAGAGATGGGTGGG - Intergenic
1173044456 20:39496243-39496265 GGGGGTGTGAAGGGAGAGGATGG + Intergenic
1173413125 20:42832359-42832381 GAGGGTGGAGAGGGAGAGGAGGG + Intronic
1173450008 20:43155524-43155546 GATGGTTAGCAGGGAGAGGATGG + Intronic
1173471187 20:43324833-43324855 GAGGGTGCATGGAGAGAGGAGGG - Intergenic
1173857254 20:46258408-46258430 GAGGGGGTGCAGGGAGAAGGAGG - Intronic
1174130050 20:48337796-48337818 GAGGGTGGGGAGTGGGAGGAGGG + Intergenic
1174150521 20:48483134-48483156 GAGGGTATGCAGCGAGGGAATGG + Intergenic
1174313387 20:49677326-49677348 GATGGTGTGCAGAGGGTGGTTGG - Intronic
1174885098 20:54325140-54325162 GAGAGTGGGCAGAGGGAGGTAGG + Intergenic
1174905243 20:54543601-54543623 GAGAGAGAGGAGAGAGAGGAGGG + Intronic
1174991713 20:55518090-55518112 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1175120143 20:56710778-56710800 GAGGGAGAGGAGGGAGAGGAGGG - Intergenic
1175215020 20:57387657-57387679 GAGGATGTGCAGAGAGGAGCAGG - Intergenic
1175248288 20:57594277-57594299 GAGGGTCTGCAGAGATGGGGTGG + Intergenic
1175366867 20:58461674-58461696 GGGAGTGAGGAGAGAGAGGAGGG - Intronic
1175392497 20:58636073-58636095 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175392534 20:58636193-58636215 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175434204 20:58931184-58931206 GAGGTGGCACAGAGAGAGGAGGG + Intergenic
1175574384 20:60049894-60049916 GTGGGAGGGCAGAGAAAGGAAGG - Intergenic
1175890560 20:62314063-62314085 GCGGGTGGGCACAGAGACGAGGG + Intronic
1175988113 20:62774358-62774380 GAGGTTGTGCACACAAAGGAAGG - Intergenic
1176033099 20:63023319-63023341 AAGGGTGTGAAGAGGGAAGAGGG - Intergenic
1176383989 21:6127889-6127911 GAGGGAGGGAGGAGAGAGGAGGG + Intergenic
1176631122 21:9138697-9138719 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1176666875 21:9695901-9695923 GTGGGTGTGCAATGGGAGGAAGG + Intergenic
1176808943 21:13517377-13517399 GAGGGTGGCGAGAGGGAGGAGGG + Intergenic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1177319146 21:19497630-19497652 GAGTGTGTGCTGGGCGAGGATGG - Intergenic
1177674374 21:24277312-24277334 GAGGGAGTGGGGAGAGAGGGAGG - Intergenic
1177740039 21:25143478-25143500 GAGGGTGTAAAGAGTCAGGAAGG - Intergenic
1178375035 21:32059624-32059646 GAAGGTGTGCAAAGAGCTGAAGG + Intergenic
1178398126 21:32260546-32260568 GAGAGACTGCAGAGAGAGAAAGG + Intergenic
1178453443 21:32726564-32726586 GAGGGGGTGCAGGGAGATGCAGG - Intronic
1178505272 21:33157462-33157484 GAGAGAGAGAAGAGAGAGGAAGG - Intergenic
1178627068 21:34227201-34227223 GAGGGTATGATGGGAGAGGATGG + Intergenic
1178777063 21:35561948-35561970 GAGGAGGAGGAGAGAGAGGAAGG + Intronic
1178879877 21:36441008-36441030 GAGGGTGAGGGGTGAGAGGAGGG - Intergenic
1179161286 21:38901345-38901367 AAAGGAGTGCAGAGAGAGGAAGG - Intergenic
1179319773 21:40279487-40279509 GAGGATGTGGAGAAATAGGAAGG + Intronic
1179348389 21:40583498-40583520 GAGGGTGGGAAGAGACAGGTGGG - Intronic
1179368288 21:40779863-40779885 GAAGGTGTGCAGAGACCAGATGG + Intronic
1179501198 21:41810057-41810079 GGGGGTCTGCAGAGGGAGGTGGG + Intronic
1179739485 21:43410349-43410371 GAGGGAGGGAGGAGAGAGGAGGG - Intergenic
1180192188 21:46170794-46170816 GAGGATGTTCAGAGAGCAGAGGG - Intronic
1180260518 21:46665553-46665575 GAGGGTGGGCACTGAGTGGAAGG - Intergenic
1180375470 22:12088906-12088928 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
1180598572 22:16997272-16997294 GAGGATGTGGAGAAATAGGAAGG - Intronic
1180618278 22:17143126-17143148 GAGGGGCTGCAGAGAGACAAAGG + Exonic
1180681912 22:17633952-17633974 GGTGGTGTGCAAAGGGAGGAGGG - Intronic
1180890979 22:19288829-19288851 GTGGGTGTGGGCAGAGAGGAAGG + Intronic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181582730 22:23837026-23837048 GAGGGTGGGGAGAGGGAGGGAGG + Intronic
1181764224 22:25079710-25079732 GAGAGTGGGCAGTGAGAGCAGGG + Intronic
1181958539 22:26605882-26605904 GTGGCAGGGCAGAGAGAGGAAGG + Intronic
1182050532 22:27309675-27309697 GAAGGTGTCCTAAGAGAGGATGG + Intergenic
1182408159 22:30156130-30156152 GAGCCTGTGCAGTGTGAGGAGGG - Intronic
1182465837 22:30515632-30515654 GGCGGTGTGCAGGGAGATGAGGG - Intergenic
1182573767 22:31259080-31259102 AAGGGTGTACAAAGGGAGGAAGG - Intronic
1182679024 22:32063851-32063873 GAGGGAGTCCAGAATGAGGAAGG + Intronic
1182694924 22:32191849-32191871 GACGGTGTGATGACAGAGGAAGG + Intronic
1182876357 22:33694701-33694723 GAAGGTGTGGAGAGACAGGAGGG + Intronic
1183235496 22:36613967-36613989 GAGGGTGTTCTGAGAGTGCAGGG - Intronic
1183317011 22:37142393-37142415 GAGAGAGTGCAGGGAGAGGGTGG - Intronic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183354556 22:37351207-37351229 GAGGGAGAGAAGAGAGAAGAGGG - Intergenic
1183464341 22:37972124-37972146 GAGGGGGGAGAGAGAGAGGAGGG + Intronic
1183578525 22:38707826-38707848 GATGGTGTGGAGGGAGAGAAGGG + Intronic
1183986640 22:41573917-41573939 GAGGGTGCGTTGGGAGAGGAGGG + Intronic
1184096068 22:42317174-42317196 GAGGGTGTGCCGAGTGAGGGCGG - Intronic
1184226162 22:43129961-43129983 GAGTCTGTGCAGGGAGAGGCAGG - Intergenic
1184380209 22:44140646-44140668 GATGAGGAGCAGAGAGAGGAAGG - Intronic
1184857419 22:47153980-47154002 GAGGGTGGGCAGAGAGTAGGAGG + Intronic
1184895222 22:47402783-47402805 GTGACTGTGGAGAGAGAGGAAGG + Intergenic
1184935684 22:47718704-47718726 GAGGCTGGGCAGGGAGAGCAGGG - Intergenic
1184979155 22:48084035-48084057 GAGGGTCTGCAGAGGCAGGCAGG - Intergenic
1185397628 22:50600914-50600936 GGGGGTGCGCAGGGAGCGGAGGG - Intronic
1185402862 22:50627559-50627581 GAGGGTGTGCACAGAGACACAGG + Exonic
1185419575 22:50728037-50728059 GTGGGTGTGCAGAGAGGCCATGG + Intergenic
1185422890 22:50744892-50744914 GAAGGTGAGCAGAGATAGGGTGG - Exonic
949415889 3:3813852-3813874 GAGGGTGGGAAAAGAGAGGCTGG - Intronic
950094343 3:10319979-10320001 GAGGGAGTGGGGAGAGAGGGAGG + Intronic
950101582 3:10360118-10360140 TGGGGGCTGCAGAGAGAGGAAGG + Exonic
950369977 3:12520929-12520951 GAGGGTGAAGAGAGGGAGGAGGG - Intronic
950565329 3:13766597-13766619 CATGGTGTGCAGAGAGATGGTGG - Intergenic
950648421 3:14392350-14392372 GAAGGTGTGCAGCCACAGGAGGG - Intergenic
950886619 3:16367971-16367993 GAAGGTGTGCAGAGAGGTGCTGG - Intronic
951320920 3:21244227-21244249 GAGGATGTGGAGAAATAGGAAGG - Intergenic
951436805 3:22675008-22675030 GAGGATGTGTAGAGAGAGATAGG - Intergenic
951720496 3:25692697-25692719 GAGGTTGTGGAGAAAAAGGAAGG - Intergenic
951912889 3:27769754-27769776 GATGGTGATCAGAGACAGGAAGG - Intergenic
952704402 3:36362780-36362802 GAGGGTGTCAAGAGGAAGGAGGG - Intergenic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
952888657 3:38027001-38027023 GGGGGTGTTCAGTGAGGGGAGGG + Intronic
952894769 3:38071011-38071033 GATGGTATGGAGAGAGAGAATGG + Intronic
952931184 3:38362063-38362085 GAGGGAGTGGATAGAGATGATGG - Intronic
953039247 3:39240207-39240229 GAGGTTGTACAGAAAAAGGAAGG - Intergenic
953666621 3:44930306-44930328 GGGGGTGAGCAGGGAGGGGAAGG + Intronic
953694425 3:45146456-45146478 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
953813716 3:46135684-46135706 TGGGGTGAGCAGAGAGAGGGAGG - Intergenic
953953322 3:47210118-47210140 GAGAGTGAGCAGAGACAGTATGG - Intergenic
954048175 3:47951326-47951348 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
954111947 3:48438790-48438812 GAGGTTGAGCAGAGAGACAATGG - Intronic
954169315 3:48787941-48787963 CAGAATGTGCAGAGACAGGAAGG - Intronic
954361564 3:50125265-50125287 GGGGGTGTGCAGAGGGGGGGAGG + Intergenic
954569898 3:51631979-51632001 GAGGCTGAGAAGGGAGAGGAGGG - Intronic
954645743 3:52130586-52130608 GAGGACATGCAGAGAGAGAACGG - Intronic
954929121 3:54265213-54265235 GAGGATGTGGAGAAACAGGAAGG - Intronic
955035639 3:55264567-55264589 GAGGATGAGGAGAGAGAAGAAGG + Intergenic
955056246 3:55458439-55458461 GAGGGTGGGGAGGCAGAGGATGG - Intergenic
955083943 3:55683878-55683900 GGGGAGGTGCACAGAGAGGAGGG + Intronic
955089886 3:55739388-55739410 GAGGATGTGGAGAAATAGGAAGG - Intronic
955217722 3:56998222-56998244 GTGTGTGTGCAGAGAGAGTTTGG - Intronic
955688020 3:61563907-61563929 GAGGATGCGCAGAGAGAAAAGGG - Intronic
956396089 3:68827514-68827536 GAGGATGTGGAGAAATAGGAAGG - Intronic
956460427 3:69466021-69466043 GAGGATGTGGAGAAATAGGAAGG - Intronic
956659992 3:71587915-71587937 GAGAGGGTGGAGAGAAAGGACGG - Intergenic
957169723 3:76722601-76722623 GAGGGTGTAGGGAGAGAGAATGG - Intronic
957201853 3:77146278-77146300 GAGGGTGGAGAGAGGGAGGAAGG + Intronic
957319506 3:78611350-78611372 GAGAGGTTGAAGAGAGAGGATGG + Intronic
957699551 3:83690789-83690811 GAGGATGTGGAGAAATAGGAAGG + Intergenic
958422774 3:93947179-93947201 GAGGATGTGGAGAAATAGGAAGG + Intronic
958503197 3:94941051-94941073 GGGGGTGAGGAGAGAGGGGAGGG - Intergenic
959181092 3:102981006-102981028 GAGGATGTGGAGAAAGGGGAAGG + Intergenic
959381331 3:105644598-105644620 GAGCGTGTACAGTGAGAGAAAGG - Intergenic
959582779 3:107999264-107999286 GGAGGTTTGCAGAGAGAGGAAGG + Intergenic
959653730 3:108777699-108777721 GAAGGTGGGAAGAGAGGGGATGG + Intergenic
959784387 3:110276599-110276621 GAGGGAGGGGAGAGAGGGGAGGG - Intergenic
960019791 3:112935941-112935963 GAGGGTGGGGAGTGGGAGGAGGG - Intronic
960188810 3:114677844-114677866 AAGAGTAGGCAGAGAGAGGAAGG - Intronic
960658135 3:120028750-120028772 GAGGCTGGGCAGAGAGAGGTTGG + Intronic
961034077 3:123630058-123630080 GAAGGTGTGTGGAGAGAGGTGGG - Intronic
961373719 3:126448806-126448828 GAGGGTGTGTGGAGCGAGGCAGG - Intronic
961462152 3:127057673-127057695 GAGTGTCTTCAGAGAGAGAAGGG - Intergenic
961537256 3:127577715-127577737 GGGGGTGAGAAGGGAGAGGAAGG - Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
961809530 3:129513925-129513947 AAGGGTGTGCAGACAGAGTGGGG + Intronic
961829908 3:129618122-129618144 GAGGGTGGTCAGGCAGAGGAGGG + Intergenic
962019027 3:131477404-131477426 GATGGATTGCAGAGAGTGGATGG - Intronic
962121983 3:132571129-132571151 GAGGTTGTGGAGAAAAAGGAAGG - Intronic
962443312 3:135443182-135443204 GAGATTTTGCAGAGAGAGCATGG - Intergenic
962642063 3:137398022-137398044 GAGGATGTGGAGAAATAGGAAGG + Intergenic
962811486 3:138962404-138962426 GAGGGTGTGGAGAGACAGAGAGG + Intergenic
962967287 3:140366646-140366668 GAGCTGGTGCAGAGAGTGGAGGG - Intronic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963689752 3:148483647-148483669 GAGGATGTGGAGAAATAGGAAGG + Intergenic
963691155 3:148504494-148504516 GAGGATGTGGAGAAATAGGAAGG - Intergenic
963805895 3:149722619-149722641 GAAGGTGAACAGAGAGAGAAAGG - Intronic
963919020 3:150888126-150888148 GAGGGCCTTCAGAGAGAGCATGG - Intronic
963941463 3:151099871-151099893 GAGAGTGTGCAAAGAGATGGAGG + Intronic
964128883 3:153265841-153265863 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
964245649 3:154649730-154649752 GAGGATGTGGAGAAATAGGAAGG + Intergenic
964390781 3:156195414-156195436 GAGGATGTGGAGAAATAGGAAGG - Intronic
964607180 3:158571803-158571825 GAGGGTGTGAGGTGAGGGGAAGG + Intronic
964607307 3:158572206-158572228 GAGGGTGTGAGGTGAGGGGAAGG + Intronic
964688329 3:159422593-159422615 GAGGGTGGGCAGTGATTGGAAGG - Intronic
965308985 3:167104622-167104644 GAGGGTGGGGGGTGAGAGGAGGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965538173 3:169846700-169846722 GAGGGTGTGTGGAGAGATGAGGG - Intronic
966002510 3:174967652-174967674 GAGGCTGTGTAAAGAGAGAAAGG + Intronic
966560961 3:181319884-181319906 GAGGATGTGGAGAAATAGGAAGG - Intergenic
966888674 3:184390596-184390618 GAGGGAGGGGAGAGAGAAGAGGG - Intronic
966924946 3:184638610-184638632 GAAGGTGAGCAGAGAGAGGTTGG + Intronic
967344055 3:188433732-188433754 GAAGGTATGGAGAGACAGGAGGG + Intronic
967429225 3:189362180-189362202 GTGAGTGAGCAGAGAGAGAAGGG - Intergenic
968339216 3:197941158-197941180 GAGAGAGAGGAGAGAGAGGAAGG - Intronic
968464146 4:742117-742139 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968464167 4:742181-742203 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968464187 4:742241-742263 GAGCCTGGGCAGAGAGAGGAGGG - Intronic
968577776 4:1375957-1375979 GGGGGTGGGGAGGGAGAGGAGGG + Intronic
968585147 4:1412865-1412887 GAGGCGGTGCAGGAAGAGGATGG + Intergenic
968610701 4:1555667-1555689 GACGGTCTGCAGAGAGAGACAGG - Intergenic
968692726 4:2003240-2003262 GAGGCTGTGGAGAAATAGGAAGG + Intronic
968889332 4:3359280-3359302 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
968957373 4:3726178-3726200 GAGGGAGAGGAGAGAGAGAAAGG + Intergenic
968957440 4:3726456-3726478 GAGGGAGAGGAGAGAGAGGAAGG + Intergenic
968960781 4:3742467-3742489 GGGGGTGTGAAGGGGGAGGAAGG - Intergenic
969072221 4:4548644-4548666 AAGTAAGTGCAGAGAGAGGAAGG + Intergenic
969264850 4:6057678-6057700 GAGGGGGTGCACACAGAGGTGGG - Intronic
969270310 4:6095092-6095114 GAGGAAGGGGAGAGAGAGGAAGG + Intronic
969307146 4:6332343-6332365 TGGGGTGTGCAGTGTGAGGAGGG + Intronic
969454757 4:7294806-7294828 GAGGGGGAGGAGGGAGAGGAGGG - Intronic
969454769 4:7294830-7294852 GAGGGGGAGGAGGGAGAGGAGGG - Intronic
969454828 4:7294987-7295009 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
969456623 4:7303877-7303899 GAGTGTGGGGAGAGAAAGGATGG + Intronic
969481592 4:7449359-7449381 GAGGGAGGGGAGAGAAAGGAAGG - Intronic
969621030 4:8278985-8279007 GAGGAGGGGCGGAGAGAGGAGGG - Intronic
969670254 4:8586191-8586213 TAGGCTGTGCTGAGAGCGGAGGG + Intronic
969869818 4:10097555-10097577 AGGGGTGTGCAGAGAGAGGGAGG - Intronic
970255933 4:14170477-14170499 GATGGTATGGAGAGAGAGAATGG + Intergenic
970680321 4:18499696-18499718 GAGGATGTGGAGAGATAGGAAGG + Intergenic
971074978 4:23137694-23137716 GTGTGTGTACAGAGAGTGGAAGG + Intergenic
971642009 4:29146334-29146356 GAGGATGTGGAGAAATAGGAAGG - Intergenic
972325375 4:38010580-38010602 GAGGGAGTGCAGAGTGGAGAAGG - Intronic
972341211 4:38154246-38154268 GGGGCTGTGCTGAGACAGGAGGG + Intergenic
973172728 4:47165322-47165344 GAGGGAGTCAACAGAGAGGAAGG - Intronic
973673359 4:53239412-53239434 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
973759177 4:54101010-54101032 GACAGGGTGAAGAGAGAGGACGG + Intronic
973875323 4:55212084-55212106 TAGGGTGCGGGGAGAGAGGAGGG + Intergenic
973953595 4:56041067-56041089 GAGGTTGAGCAATGAGAGGAAGG - Intergenic
975291705 4:72685094-72685116 GAGGATGTGGAGAAATAGGAAGG + Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
975655927 4:76641316-76641338 GAGGATGAGCAGGGAGAAGATGG - Intronic
975994206 4:80295628-80295650 GTGGGTGTGCAGCCAGAGGCAGG + Intronic
976561155 4:86503027-86503049 GAGGGACTGCTGAAAGAGGATGG + Intronic
977326009 4:95575510-95575532 GAGGATGTGGAGAAATAGGAAGG - Intergenic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
977740169 4:100470401-100470423 GAGGTTGTGGAGAAAAAGGAAGG + Intronic
977744368 4:100528002-100528024 GAGGATGTGGAGAAATAGGAAGG - Intronic
977815850 4:101413099-101413121 GAGGCTGTGGAGAAATAGGAAGG + Intronic
978263580 4:106793986-106794008 GGGGGTGTGTGGAGAGGGGAGGG - Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
979501486 4:121445604-121445626 GAGGATGTGGAGAAATAGGAAGG + Intergenic
979814702 4:125086431-125086453 AAGGAGGTGGAGAGAGAGGAGGG - Intergenic
980254167 4:130355392-130355414 GAGGGGGTACAGGGAGGGGATGG - Intergenic
980333019 4:131434305-131434327 GAGGGTCAGCGGGGAGAGGAGGG - Intergenic
980538490 4:134161328-134161350 GAGGATGTAGAGAGAGAGAATGG + Intergenic
980896998 4:138869158-138869180 GAGGGTGAGGGGAGAGGGGAGGG + Intergenic
981105567 4:140876673-140876695 GAGGGTGAGCACATAGAAGATGG + Intronic
981444787 4:144823131-144823153 GAGGGTGGAGAGCGAGAGGAGGG - Intergenic
981704880 4:147648417-147648439 GAGGGTGCCCAGAGAGGGCATGG + Intronic
982211461 4:153039936-153039958 GAGGGAGTGAGGAAAGAGGAGGG + Intergenic
982764908 4:159335198-159335220 GGTGATGTGCATAGAGAGGAAGG + Intronic
982776924 4:159451643-159451665 GAGGGTGGGGAGTGGGAGGAGGG - Intergenic
983956454 4:173704154-173704176 GAGGGTATGCAAAGAAAAGAAGG - Intergenic
984248311 4:177302158-177302180 AAGAGGGTGCTGAGAGAGGATGG + Intergenic
984481316 4:180306628-180306650 GAGGGTGGGGAGTGGGAGGAGGG - Intergenic
984870677 4:184322332-184322354 GAGGGTGGAGGGAGAGAGGAGGG - Intergenic
985072385 4:186180520-186180542 TAGGGTGTGGGGAGAGGGGAGGG - Intergenic
985214615 4:187637641-187637663 GAGGGTGAAGAGAGGGAGGAGGG - Intergenic
985408134 4:189656447-189656469 GTGGGTGTGCAATGGGAGGAAGG - Intergenic
1202757066 4_GL000008v2_random:74348-74370 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985652269 5:1112528-1112550 GAGGGGGTGCAGAAAGGGCAGGG - Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985668523 5:1194381-1194403 GAGGGTGGGCGGTGGGAGGAGGG - Intergenic
985729357 5:1538599-1538621 GAGGGTGTGCAGAGAAGAGAGGG - Intergenic
986463030 5:7992861-7992883 GTGCGTGTGGAGAGAGGGGAGGG + Intergenic
986487630 5:8255102-8255124 GAGGGGGTGAAGAGGAAGGAAGG + Intergenic
986541969 5:8853874-8853896 GAGGGTGGAGAGTGAGAGGAGGG - Intergenic
986788545 5:11138533-11138555 CAGGTTGGGCAGGGAGAGGATGG - Intronic
986796635 5:11219028-11219050 GAGGCTGCTCAGAGAGAGAAAGG - Intronic
987009384 5:13746230-13746252 AATGCTGTGGAGAGAGAGGATGG + Intronic
987020769 5:13868694-13868716 GAGGGAGGGAAGAGAGAGAAAGG - Intronic
987112432 5:14700580-14700602 GAGGGTGAGCACAGAGGGTATGG - Intergenic
988084472 5:26457581-26457603 GAGGATGTGGAGAAATAGGAAGG - Intergenic
988318102 5:29657811-29657833 GAGGGTGGAGGGAGAGAGGAGGG + Intergenic
988423926 5:31040344-31040366 GAGGGTGGGCAGCAAGGGGAGGG + Intergenic
988792346 5:34620207-34620229 GAAGGTGAGCACAGAGAAGAGGG + Intergenic
989605690 5:43242387-43242409 GAGCAGGTGCAGAGAGAGGCAGG + Intronic
990098779 5:52156486-52156508 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
990123424 5:52484327-52484349 GGGGGTATCCAGAGAGAGAAAGG + Intergenic
990536805 5:56731368-56731390 GAGGATGTGGAGAAATAGGAAGG + Intergenic
990783184 5:59389840-59389862 GAGGCTGGGAAGAGAGAGGTGGG + Intronic
991406550 5:66305829-66305851 GAGGGAGTTGAGAGAGAAGAAGG + Intergenic
991515246 5:67427973-67427995 AAGGGAGAGAAGAGAGAGGAAGG - Intergenic
992533115 5:77671411-77671433 GAGGGGGTGGAGGGAGTGGAGGG + Intergenic
992895046 5:81238647-81238669 GAGGGACTGCAGAGACAGGTTGG - Intronic
993357831 5:86936979-86937001 GAGGATGTGGAGAAATAGGAAGG - Intergenic
993460794 5:88178032-88178054 GAGGTTGTGGAGAAAAAGGAAGG - Intergenic
993570710 5:89535476-89535498 GAGATTGTGAAAAGAGAGGAAGG + Intergenic
993581660 5:89669338-89669360 GATGGTGTGAAGAGGAAGGAAGG - Intergenic
994345891 5:98685751-98685773 GAGGATGTGAAGAAATAGGAAGG + Intergenic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
995028465 5:107451736-107451758 GAGGCTGTGGAGAAACAGGAAGG + Intronic
995126933 5:108586883-108586905 GAGGGTGGGGAGAGAGGGAAGGG + Intergenic
995174695 5:109161897-109161919 GAGGTTGTAGAGAGAAAGGAAGG - Intronic
995682414 5:114734760-114734782 GAGGGTGGAGAGTGAGAGGAAGG - Intergenic
996070263 5:119123377-119123399 GAGGGAGAGGAGGGAGAGGAGGG + Intronic
996109835 5:119552312-119552334 GAGGCTGTGGAGAAATAGGAAGG - Intronic
996976486 5:129440648-129440670 GATGGATTGGAGAGAGAGGAAGG - Intergenic
997234599 5:132265539-132265561 GAGGAAGTGCAGAGTGAGTATGG + Intronic
997262389 5:132475067-132475089 GGGGGTGTGGAGATGGAGGAGGG + Intronic
998093128 5:139382449-139382471 GGGAGTGTGCAGAGTGAGGGCGG + Intronic
998447566 5:142210646-142210668 GAGGGAGGGGAGAGGGAGGAAGG - Intergenic
998496440 5:142594479-142594501 GTGGGAGTGCAGAGAAAGAAAGG - Exonic
998842609 5:146271553-146271575 GAGGGCGTGGAGGAAGAGGAAGG + Exonic
998885708 5:146691740-146691762 GTGAGTGAGCAGGGAGAGGATGG - Intronic
998929995 5:147171028-147171050 GAGGATGTGGAGACATAGGAAGG + Intergenic
999080341 5:148837619-148837641 GCTGCTGTGCAGAGAAAGGAAGG + Intergenic
999212833 5:149905216-149905238 GAGTGGGTGGAGAAAGAGGAGGG - Intronic
999268238 5:150280836-150280858 GAGGGTGGGTAGAAAGAGGCCGG - Intronic
999321557 5:150618497-150618519 GAGGGCCTGCAGGGAGAGGTGGG + Exonic
999474031 5:151881665-151881687 GAGTCTGTGCAGCAAGAGGAAGG - Intronic
999712690 5:154332431-154332453 GAGGGCGTTCAGGCAGAGGAAGG - Intronic
1000170940 5:158702561-158702583 GAGGGTTTGGAGTGAGAGGGTGG + Intronic
1000214785 5:159145049-159145071 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1000284211 5:159812638-159812660 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1000721870 5:164718388-164718410 GAGGGTGAGGAGTGGGAGGAGGG - Intergenic
1000772029 5:165366295-165366317 GAGGGAGGGCGGAGGGAGGAAGG + Intergenic
1000937193 5:167316951-167316973 GGGGGTGTGCAGAGGAAGGCTGG - Intronic
1001380667 5:171304488-171304510 GAGGATGGGCAGAGAGGTGAGGG + Intergenic
1001398886 5:171435142-171435164 GAGGGAGTGGTGGGAGAGGAAGG + Intronic
1001417465 5:171556006-171556028 GAGGGGGTGGCGGGAGAGGAGGG - Intergenic
1001753362 5:174147984-174148006 GAGGGTGGGCAGGGAGGGCAGGG + Intronic
1001960083 5:175874716-175874738 GAGGGGAGGCAGAGAGAGGGAGG + Intronic
1002076756 5:176712964-176712986 GAGGCTGTAGTGAGAGAGGAGGG + Intergenic
1002277256 5:178112109-178112131 GAGGCTGTGGGGAGAGAGAAAGG - Intergenic
1002467685 5:179415996-179416018 CAGGGTCTGCAAAGAGAGGTGGG + Intergenic
1002651813 5:180703259-180703281 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003076537 6:2988157-2988179 GAGGTTTTGCAGGGAGAGCAGGG + Intronic
1003346920 6:5278321-5278343 GAGGGTGTGTAGACAGAGCTTGG + Intronic
1003431024 6:6037644-6037666 GGGGGTGTGAAGAGCGGGGAGGG - Intergenic
1003447827 6:6200792-6200814 CAGGGTCTGCAGGGAGAGAAGGG + Intronic
1003520493 6:6854545-6854567 AGTGGTCTGCAGAGAGAGGAAGG - Intergenic
1003565980 6:7222576-7222598 GAAGGTGTCCAGAAACAGGAGGG + Intronic
1003608974 6:7591002-7591024 GAAGGTGTGTTGAGTGAGGAGGG + Intronic
1003971486 6:11304318-11304340 GAGGATGTGGAGAAATAGGAAGG + Intronic
1004365812 6:15011653-15011675 GAGGGTGGTGAGTGAGAGGAGGG + Intergenic
1004764835 6:18714507-18714529 GAGGGTGGGGAGTGGGAGGAGGG - Intergenic
1005712952 6:28520052-28520074 GAGGGATTGCAGAGCGAGAAAGG + Intronic
1005796309 6:29365666-29365688 GAGGATGTGGAGAAATAGGAAGG + Intronic
1005806853 6:29481477-29481499 GAGGATGTGGAGAAACAGGAAGG - Intergenic
1005846791 6:29787814-29787836 GAGGTTGTGGAGAAATAGGAAGG + Intergenic
1005950327 6:30626816-30626838 GAGGCGGTGCGGCGAGAGGAGGG + Intergenic
1005959204 6:30684255-30684277 GTGTATGTGCAGAGCGAGGAAGG + Intronic
1005987345 6:30883339-30883361 GGGGGTGTGGAGAGAGGTGAGGG + Intronic
1006059570 6:31410367-31410389 GAGGGTGGGAGGATAGAGGAGGG - Intronic
1006072059 6:31505438-31505460 GAGGGTGGGAGGATAGAGGAGGG - Intronic
1006088818 6:31615902-31615924 GAGGGGATGCTGAGAGAGGCAGG - Intronic
1006162452 6:32046453-32046475 GGAGCTGTGCAGAGGGAGGAGGG + Intronic
1006174515 6:32113981-32114003 GAGGGGGTGCAGTGAGAACAAGG - Intronic
1006255667 6:32830207-32830229 GAGCATGTACAGAGAGAGGATGG - Intronic
1006299430 6:33185788-33185810 GGGGGTGGGCATAGACAGGAAGG + Intronic
1006385683 6:33729508-33729530 GAGGGTGGGAGGAGAAAGGATGG + Intronic
1006618224 6:35343850-35343872 GAGTGAGGGCAGAGAGAGGCTGG - Intronic
1006641686 6:35492591-35492613 GGGGGTGGGGAGAGAGTGGAGGG - Intronic
1006667616 6:35707690-35707712 GAGGGTGGGAGGAGAGAGAAGGG - Intronic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007272348 6:40647895-40647917 GAAGGTGTGGACAGAGAGAATGG + Intergenic
1007290548 6:40782909-40782931 GAGGATCAGCAGGGAGAGGAGGG - Intergenic
1007307064 6:40915193-40915215 TAGGGTCTTCAGAGAGAGCATGG - Intergenic
1007402397 6:41610843-41610865 GTGGCTGTGAACAGAGAGGAAGG + Intergenic
1007662751 6:43496579-43496601 CAGGCTGTCCAGACAGAGGAGGG + Intronic
1007663921 6:43503333-43503355 GAGGAGGTGGAGGGAGAGGAAGG + Intronic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007742530 6:44021645-44021667 GAGGGTGTGCAGAGGGATTAGGG + Intergenic
1007803458 6:44418136-44418158 GAGGGTGGGGGGAGAGGGGAGGG - Intronic
1007811379 6:44488497-44488519 GAGGGTGGGGATTGAGAGGAGGG - Intergenic
1007962204 6:45970069-45970091 GGGGGTGAGGAGAGGGAGGAAGG - Intronic
1008045549 6:46848298-46848320 GAGGGGGGACAGAGAAAGGAAGG + Intergenic
1008237527 6:49068324-49068346 GTGGGTGGGCAGACTGAGGATGG + Intergenic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008409100 6:51152528-51152550 GAGGGTGTGAAGATAGTGGAGGG - Intergenic
1008413065 6:51205848-51205870 GGGGGTGTGTAGAAAGAGGAAGG + Intergenic
1008971332 6:57372596-57372618 GAGGGTGGGAGGTGAGAGGAGGG - Intronic
1009037090 6:58130607-58130629 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1009160292 6:60274398-60274420 GAGGGTGGGAGGTGAGAGGAGGG - Intergenic
1009724183 6:67515149-67515171 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1009860383 6:69322481-69322503 GAGGTTGTGCAGAAAAAGGAAGG - Intronic
1009862002 6:69346715-69346737 GAGGATGTGGAGAAATAGGAAGG + Intronic
1010020078 6:71149293-71149315 GAGGGTGTGGGGTGAAAGGAGGG + Intergenic
1010338643 6:74721361-74721383 AGGGGTGTGCACAGAGAGAAAGG - Intergenic
1010467551 6:76186740-76186762 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1011299009 6:85854198-85854220 GAGGGTGAGCAGAAACAGGGTGG - Intergenic
1012591899 6:100992252-100992274 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1013230608 6:108158208-108158230 AAGGGTGTGGGGAGAGAGAAAGG - Intronic
1013422260 6:109977989-109978011 GAGGGTGAGCTGGGAGGGGAGGG - Intergenic
1014359117 6:120453230-120453252 GAAGGTGGGGAGTGAGAGGAGGG + Intergenic
1014444850 6:121515088-121515110 GAGGGAGAGCAGATAGAGTATGG + Intergenic
1015159709 6:130138949-130138971 GAAGATGTCCAGAGAGAGGAAGG + Intronic
1015189835 6:130460602-130460624 GTGGGTGAGAAGAGAGTGGATGG - Intergenic
1015254649 6:131164400-131164422 GAGCAGGTGCTGAGAGAGGAAGG + Intronic
1015465342 6:133542806-133542828 GTGTGTGTGCAGAGGAAGGAGGG + Intergenic
1015859229 6:137658014-137658036 AAGGCTGTTCAGAGAGAGAAAGG + Intergenic
1015874522 6:137809291-137809313 GTGGGCTGGCAGAGAGAGGAGGG - Intergenic
1016311002 6:142733581-142733603 GAGAGTGTGCAGGGTGAGTAAGG - Intergenic
1016404593 6:143716830-143716852 CTGGGTGAGCAGGGAGAGGAGGG + Intronic
1016487843 6:144562832-144562854 GAGGCTGTGGAGAAATAGGAAGG - Intronic
1016731554 6:147433075-147433097 GAGGGTGGGTTGGGAGAGGAAGG - Intergenic
1016867331 6:148780427-148780449 GAGGGTGGGGAGTGGGAGGAGGG - Intronic
1017238257 6:152139601-152139623 GAGGGAGGGGGGAGAGAGGAAGG + Intronic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1017573445 6:155773809-155773831 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1017991974 6:159497794-159497816 GAGGGTGGAGAGTGAGAGGAGGG + Intergenic
1018596016 6:165481394-165481416 GGGGGTGTGGAGATAGGGGAGGG - Intronic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1018788852 6:167130974-167130996 GAGGGGGTCCAGAGGGAGGGTGG - Intronic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1018867734 6:167758941-167758963 GACGGGGGGCAGAGGGAGGAGGG - Intergenic
1019067658 6:169315929-169315951 GTGTGTGTGCAGACACAGGAGGG - Intergenic
1019466769 7:1193965-1193987 CAGGGTGTCCTGAGAGAGGTAGG - Intergenic
1019470253 7:1216019-1216041 GAGGGAGGGCAAAGAGAGGTTGG - Intergenic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019709646 7:2512342-2512364 AACGGGCTGCAGAGAGAGGACGG + Intergenic
1019743491 7:2687473-2687495 GAGGGTTTGCAGAGAGGAAAAGG + Intronic
1019856471 7:3613431-3613453 GAGGTTGTGGAGAAAAAGGAAGG - Intronic
1020005712 7:4782948-4782970 CTGGGTGTGCAGAGTGAGGTGGG + Intronic
1020011411 7:4807726-4807748 GAGGGAGGGCAGAGAGACGGAGG - Intronic
1020011490 7:4808002-4808024 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
1020231711 7:6324211-6324233 GAGGGTGAGCTGAGAAAAGAGGG - Intergenic
1020390909 7:7656944-7656966 GAGGATGTGTAGAAATAGGAAGG - Intronic
1020525739 7:9256357-9256379 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1021317810 7:19171523-19171545 AAGGGAGTGGAGAGAGAGTAGGG - Intergenic
1021481347 7:21121096-21121118 GAGGGCAAGAAGAGAGAGGAAGG - Intergenic
1021827960 7:24573411-24573433 GAGGGGGAGGAGAGAGAGGGAGG + Exonic
1021864324 7:24939836-24939858 GAGGGTGGGAGGAAAGAGGAGGG + Intronic
1021889932 7:25177950-25177972 GAGGGTGGAGAGAGGGAGGAAGG - Intronic
1021896682 7:25243196-25243218 GAGGGAGTGGGGAGAGCGGAAGG - Intergenic
1022038013 7:26552253-26552275 GAGGGAGTGCAGAGGAGGGATGG + Intergenic
1022075758 7:26968328-26968350 GAGGGTGGAGAGTGAGAGGAAGG - Intronic
1022174365 7:27859236-27859258 GAGGATGTGGAGAAACAGGAAGG + Intronic
1022228743 7:28392122-28392144 GAGGGTGGACGGAGGGAGGAAGG + Intronic
1022558857 7:31328183-31328205 GAGGGTGTGGAGAAATAGGAAGG - Intergenic
1023205946 7:37749887-37749909 GGAGGTGTGCAGAGAAAGGCAGG - Intronic
1023582312 7:41696050-41696072 GAGGGTGTGGAGAGAAATGGTGG - Intronic
1023692221 7:42801691-42801713 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1023740798 7:43278842-43278864 GAGGGTGTGGAGTGTGAGGCAGG - Intronic
1023869522 7:44255558-44255580 GAGGGTGCGGAGGCAGAGGAGGG - Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1023905831 7:44521113-44521135 GAGAGTCTGCAGAGAAAGCAGGG + Exonic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1024868545 7:53933667-53933689 GAGGCTGTGGAGAAAAAGGAAGG + Intergenic
1024883088 7:54111768-54111790 TGGGATGTGCAGAGACAGGAAGG - Intergenic
1025049588 7:55723128-55723150 GAATGTGTGCAGAGGGAGGTGGG - Intergenic
1025198869 7:56949940-56949962 GAGGGAGGGAAGAGAGAGGGAGG - Intergenic
1025287478 7:57676731-57676753 GGGGGTGTGGAGCAAGAGGAGGG + Intergenic
1025673077 7:63626993-63627015 GAGGGAGGGAAGAGAGAGGGAGG + Intergenic
1026461341 7:70617840-70617862 GGCGGTGTGCAGAGAGAAGGAGG - Intronic
1026618511 7:71929272-71929294 GAGGGTGGGGAGTGGGAGGAGGG - Intronic
1026840782 7:73668902-73668924 GAGGGGGTGCTGTGAGGGGACGG + Intronic
1026868018 7:73835149-73835171 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026868021 7:73835158-73835180 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026868024 7:73835167-73835189 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026868027 7:73835176-73835198 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1027232527 7:76281029-76281051 GAGGGTGAGAGGAGAGAGCAAGG - Intronic
1027418755 7:77999571-77999593 GAGGGAGGGCAGGGAGAGGAGGG + Intergenic
1027605568 7:80294311-80294333 GAGGGAGTGGGGAGGGAGGAAGG - Intergenic
1027766747 7:82353533-82353555 GAGAGTGTACAGCGAAAGGAAGG + Intronic
1028208625 7:88045666-88045688 GAGGGTGTACAGAGAGACACTGG - Intronic
1028475961 7:91253371-91253393 GAGGATGTGGAGAAATAGGAGGG - Intergenic
1029101158 7:98131081-98131103 GAGGGCGTGGAGAAAGTGGACGG - Intronic
1029115209 7:98233180-98233202 GAGGGGCTGCAGACAGGGGAAGG + Intronic
1029165272 7:98584845-98584867 GAGGGAGGGAAGAGAAAGGAAGG - Intergenic
1029363606 7:100103538-100103560 GAGGGTGAGGAAAGAGAAGAGGG + Intronic
1029412782 7:100426667-100426689 GAGGGAGGGAAGAGGGAGGAAGG - Intronic
1029420266 7:100468338-100468360 AAGGGTGTGAAGGGAGAGGAAGG + Intronic
1029597631 7:101546103-101546125 AAGGAGGTGCAGAGAGTGGACGG + Intronic
1029601094 7:101563889-101563911 GGGGCTGTGGAGAGGGAGGAGGG - Intergenic
1029696646 7:102217913-102217935 GATGGTGTCTAGAGAGAGGGAGG + Intronic
1030019612 7:105260395-105260417 GAGGATGTGGAGAAATAGGAAGG + Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1030937677 7:115605964-115605986 GTGGGTGGGGAGAGAGAAGAGGG - Intergenic
1030979841 7:116173599-116173621 GAGGGTGTTGAGAGGGAAGATGG - Intergenic
1030983420 7:116211666-116211688 GAAGTTTTGCAGAGAGAGGAAGG + Intronic
1031263236 7:119549356-119549378 GTGTGTGTGGAGGGAGAGGAAGG + Intergenic
1031483601 7:122304888-122304910 GAGTGTGTGCGCAGAGGGGAGGG - Intronic
1031542873 7:123016388-123016410 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1031770230 7:125832724-125832746 GAGGTTGTTTGGAGAGAGGAGGG + Intergenic
1031808895 7:126341205-126341227 GAGGGTGTGCTGTGGGAGGGAGG - Intergenic
1031866136 7:127039998-127040020 GAGGGTGAGGAGGGAGGGGAGGG + Intronic
1031866144 7:127040016-127040038 GAGGGTGAGGAGGGAGGGGAGGG + Intronic
1031998250 7:128246909-128246931 CAGGGAGTGCAGAGAGAAGTGGG + Intronic
1032388771 7:131542233-131542255 GAGAGAGGGCAGAGAGAGAACGG - Intronic
1032825858 7:135567257-135567279 GGAGATGTGCAGGGAGAGGACGG - Intronic
1033266152 7:139888901-139888923 GAAGGGGTGCAGGGGGAGGATGG + Intronic
1033269005 7:139913893-139913915 GAGGGTGAGCAGGGAGAGGCTGG - Intronic
1033843128 7:145399326-145399348 GATGGTGAGGAGAAAGAGGATGG + Intergenic
1034422822 7:150998308-150998330 GAGGGTGAGGAGAGAGACGGGGG - Intronic
1034436423 7:151064735-151064757 GAGGGTGTGGAGACAGGGGACGG - Exonic
1034472572 7:151263350-151263372 GAGGTTGGGGAGAGAGAGGCAGG + Intronic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1034645417 7:152642037-152642059 GGGGTTGGGCAGGGAGAGGAAGG - Intergenic
1034746929 7:153530831-153530853 GAGGGTGAGCTGAAAGAGAATGG - Intergenic
1035019464 7:155792140-155792162 GAGGGATTACAGAGAGAGGGAGG - Intergenic
1035019533 7:155792384-155792406 GAGGGATTACAGAGAGAGGGAGG - Intergenic
1035518134 8:254186-254208 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035836373 8:2757605-2757627 GAGAGTCTCCAAAGAGAGGAGGG + Intergenic
1035843580 8:2839249-2839271 GAGCTTGTCCAGAGAGAGAACGG - Intergenic
1036000181 8:4593981-4594003 GAAGGTGTGGAGAGACAAGAAGG - Intronic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1036273323 8:7327793-7327815 GAGGCTGAGAAGAAAGAGGAAGG + Intergenic
1036348026 8:7982559-7982581 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036537237 8:9662103-9662125 GAGGATGTGGAGAAATAGGAAGG + Intronic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1036675101 8:10825067-10825089 GATTGTGTGCAGGGAGAGGCTGG - Intronic
1036843321 8:12143035-12143057 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036864685 8:12385350-12385372 GAGGCTGAGAAGAAAGAGGAAGG - Intergenic
1036926978 8:12916400-12916422 GAGGGAGGACAGAGAGAGGATGG - Intergenic
1037009325 8:13821001-13821023 GGGTGTGTGCAGAGAAAGAAAGG + Intergenic
1037065233 8:14568233-14568255 GGGGGTGGGGAGAAAGAGGAGGG + Intronic
1037103481 8:15076775-15076797 GGCGGTGTGCAGAGAAAGGAGGG - Intronic
1037415538 8:18645931-18645953 GAGTGTGTGCAGAGAGAGGTAGG - Intronic
1037742729 8:21620410-21620432 GAGGGTGGGAGGAGAGTGGATGG - Intergenic
1037773087 8:21814501-21814523 GAGGTGGTGGAGAGAGAGGAGGG - Intergenic
1037809180 8:22076277-22076299 AAGATTGTACAGAGAGAGGAGGG + Intronic
1037829134 8:22177813-22177835 AAGGGTGTGGGGGGAGAGGAGGG - Intronic
1037930648 8:22878199-22878221 GAGGGTGAGCATGGAGAGGGAGG + Intronic
1037993285 8:23335804-23335826 TGGGGTGTGAAGACAGAGGAAGG + Intronic
1038166551 8:25090578-25090600 GAGTGCGTGCAAAGAGGGGAAGG + Intergenic
1038441240 8:27572186-27572208 GAGGCTGGGCAGAGTGAGCATGG + Intergenic
1039281796 8:35994131-35994153 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1040454578 8:47583795-47583817 GGGTGTGTGAAGGGAGAGGAAGG - Intronic
1040986129 8:53296208-53296230 GAGGGTGGCCAGAGAGGGCATGG - Intergenic
1041172288 8:55156419-55156441 GGGGGTGGGGAGAGGGAGGAAGG + Intronic
1042626151 8:70759346-70759368 AAGGGGGTGGAGAGAAAGGAAGG + Intronic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1043406744 8:79943720-79943742 GAATGTATGCAGAGAGGGGAGGG - Intronic
1044592069 8:93922945-93922967 CTGGGTGTGCAGGAAGAGGACGG + Exonic
1045016971 8:98008688-98008710 CAGGGGGTGCAGAAAGAGGGTGG + Intronic
1045050318 8:98318854-98318876 GGGGGTGTGGAGAGAGAGAAGGG - Intergenic
1045252483 8:100493459-100493481 GTGGGTGTGAAGAGGGAGGAGGG + Intergenic
1045498295 8:102726664-102726686 GAGTGCGGGGAGAGAGAGGAAGG + Intergenic
1045648741 8:104323980-104324002 GAGGGGGTGCATGGAGAGGTTGG - Intergenic
1045711689 8:104992177-104992199 TAGGGTGAGAAGTGAGAGGAAGG - Intronic
1046146115 8:110160793-110160815 GAAGGAGTGGAGGGAGAGGAAGG + Intergenic
1046239516 8:111472328-111472350 GAGGGTGGAGAGGGAGAGGAGGG + Intergenic
1046346330 8:112932696-112932718 GAGGGGGTACAAAGAGAGGTTGG + Intronic
1046405044 8:113762431-113762453 GAGGGTGTAGAGCGGGAGGAGGG + Intergenic
1047317528 8:123748152-123748174 GAAGGTGGGAGGAGAGAGGAGGG + Intergenic
1047835006 8:128679905-128679927 AAGGGTGTCCAGGGAGAGGGAGG - Intergenic
1048365125 8:133731790-133731812 GAGGGTGTGCAGAGGAGGAAAGG + Intergenic
1048840032 8:138557607-138557629 GAGGGAGGGAAGAAAGAGGAAGG + Intergenic
1049032325 8:140047117-140047139 GAGGCTGTGCCGGGAGAGGCTGG - Intronic
1049386920 8:142347480-142347502 GTCTCTGTGCAGAGAGAGGATGG - Intronic
1049521875 8:143095450-143095472 GAGGGTGAGGAAAGCGAGGAAGG + Intergenic
1049532727 8:143163141-143163163 GATGGTGTGCAGAGAGCTTATGG + Intergenic
1049707695 8:144050522-144050544 GGTGGTCTGCAGAGAGAGGCGGG - Intergenic
1049884999 9:20990-21012 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
1050314865 9:4391069-4391091 GATGGTGGGCAGAGATAGAAAGG - Intergenic
1051342177 9:16121521-16121543 GACGGTGTGCAGAGAGGGTGGGG + Intergenic
1051347300 9:16163768-16163790 CAGGGTGTAAAGAGAGAGGAAGG - Intergenic
1051894580 9:21974648-21974670 GAGGGTCTGCAGCGGGAGCAGGG - Intronic
1052933421 9:34074263-34074285 AAGGGACTGCGGAGAGAGGAAGG - Intergenic
1052990690 9:34517886-34517908 GTGGGTCTACACAGAGAGGAAGG + Intronic
1053067773 9:35080155-35080177 GACAGTGAGCAGAGAAAGGATGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1054886712 9:70206770-70206792 TGGGGTGGGGAGAGAGAGGAAGG - Intronic
1055004590 9:71491128-71491150 GAGAGTATGTAGAGAAAGGAGGG + Intergenic
1055084998 9:72304949-72304971 GAGAGTGGGCATAGAAAGGAGGG - Intergenic
1055387105 9:75774516-75774538 GGGGGTGGGGAGAGAGAGGGAGG - Intergenic
1055555247 9:77467149-77467171 GAGGGGGTGCAGAGTGGGGCAGG + Intronic
1055863611 9:80785824-80785846 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1056587854 9:87939971-87939993 GAGGGTGGGGAGAGGGAGCAGGG + Intergenic
1056609013 9:88112974-88112996 GAGGGTGGGGAGAGGGAGCAGGG - Intergenic
1057231586 9:93324680-93324702 GAGGGTGTGTGGATGGAGGAGGG + Intronic
1057236503 9:93365937-93365959 GAGGGTGTGTGGATGGAGGAGGG - Intergenic
1057545769 9:96019846-96019868 CAGGGTGGTGAGAGAGAGGAAGG + Intergenic
1058163518 9:101595093-101595115 GAGAGGGAGCGGAGAGAGGAGGG + Intronic
1058164901 9:101608165-101608187 CAGTGTGTGTAGAGATAGGAGGG - Intronic
1058804526 9:108578032-108578054 GCGTGTGAGCAGAGAGAGAAGGG - Intergenic
1059409733 9:114124383-114124405 GAGGGGGAGGAGGGAGAGGAAGG + Intergenic
1059440548 9:114304454-114304476 GACTGTCTGCAAAGAGAGGAAGG + Intronic
1059505919 9:114799841-114799863 GAGGAAGTGCAGAGGCAGGAAGG - Intronic
1059630672 9:116118310-116118332 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1059662393 9:116414895-116414917 GAGGGTGTAGAGAGAGAGGGAGG + Intergenic
1059993916 9:119891234-119891256 GAAGGGCTGCAGAGAGAGGACGG - Intergenic
1060060913 9:120458671-120458693 TGGGGTGTGTGGAGAGAGGATGG + Intronic
1060171483 9:121465158-121465180 GAGAGTGTGCCCAGAGAGGCTGG + Intergenic
1060185625 9:121562388-121562410 GAGGCTGTGTAGAGAGGGGTAGG - Intergenic
1060389531 9:123267379-123267401 GAGGGCTTGCAGAGAGAGGTGGG - Intronic
1060944967 9:127564907-127564929 GAGCATGTACAGAGAGAGGTAGG + Intronic
1061035066 9:128108829-128108851 GGGGGCGTGGAGAGAGAGGGAGG + Exonic
1061262967 9:129490086-129490108 GAGGGTGTGTACAGCCAGGAGGG - Intergenic
1061390605 9:130315315-130315337 GGGGGAGGGCAGAGGGAGGAGGG - Intronic
1061423291 9:130483832-130483854 GAGGATGTGCAAAGAGGGAAGGG - Intronic
1061618193 9:131793902-131793924 GAGGGAGGGCAGGGAGAGGTGGG + Intergenic
1061729678 9:132604103-132604125 TGGGGTGTGCTGAGAGGGGAAGG + Intronic
1062109448 9:134773959-134773981 GAGGCTGTGCCCAGGGAGGAGGG - Intronic
1062348878 9:136129110-136129132 GAGGGTGGGTAAAGTGAGGAGGG + Intergenic
1062361921 9:136192412-136192434 GATGGTGAGGAGGGAGAGGAGGG + Intergenic
1062369760 9:136231887-136231909 GAGGGGGTGGAGAGGGTGGAGGG - Intronic
1062407331 9:136403183-136403205 GAGGGTTTCCAGAGCGGGGAGGG + Intronic
1062482833 9:136760306-136760328 GGGGGTGTGCAGGGAGACGTTGG + Intronic
1203753947 Un_GL000218v1:106313-106335 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1203713348 Un_KI270742v1:118847-118869 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1203537858 Un_KI270743v1:59208-59230 GAGGGTGTGGAGAAATAGGAAGG + Intergenic
1203659222 Un_KI270753v1:25860-25882 GTGGGTGTGCAATGGGAGGAAGG - Intergenic
1185547640 X:958255-958277 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1185616558 X:1425433-1425455 GAGCCTGGGCAGAGCGAGGAAGG - Intronic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186181400 X:6976496-6976518 GAGGGTGAGCAGAAACAGGGTGG - Intergenic
1186518653 X:10186315-10186337 GTGGGTGTGCAGAGACAGAAGGG + Intronic
1186641779 X:11463243-11463265 GGGCGTGTGGAGAGGGAGGATGG + Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1186717868 X:12272417-12272439 GAGGGTGACCAGGGAGAGGACGG + Intronic
1186909839 X:14151105-14151127 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1186992738 X:15086988-15087010 AAGGGTGAGTAGAGAAAGGAAGG + Intergenic
1187102838 X:16212745-16212767 GTGGGTGTGCAGAGAGAGCTGGG - Intergenic
1187106805 X:16251713-16251735 GAAGGTTTGCAGAGAGAAGAGGG + Intergenic
1187292735 X:17970635-17970657 CATGGTTTGCAGAGAGAGTAGGG - Intergenic
1188489503 X:30722771-30722793 GTGTGTGTGAAGAGAGAGGGGGG + Intronic
1188569098 X:31560680-31560702 GAGGAGGTGGAGGGAGAGGAGGG - Intronic
1188656142 X:32698015-32698037 GGGGGAGTGGATAGAGAGGAGGG + Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189236396 X:39490456-39490478 TAGAGTCTTCAGAGAGAGGATGG + Intergenic
1189422867 X:40872143-40872165 GTGGGGCTGCAGAGAGAAGAAGG - Intergenic
1189609865 X:42720892-42720914 GTGGGTGTGGAGAGGGGGGAGGG - Intergenic
1190457379 X:50639291-50639313 GAGGGAGAGTAGAGAGAGAATGG + Intronic
1190778778 X:53577485-53577507 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1190803183 X:53811990-53812012 GAGGGTGGGAAGTGAGAGGAAGG - Intergenic
1190981343 X:55458952-55458974 GAGGGAGAGCACACAGAGGAGGG + Intergenic
1190987355 X:55514228-55514250 GAGGGAGAGCACACAGAGGAGGG - Intergenic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1191153175 X:57242604-57242626 GAGGGTGAGCAGAAACAGGGTGG + Intergenic
1191193509 X:57693387-57693409 GAGGGTGTTGAGAGAGTGCATGG + Intergenic
1191675187 X:63785449-63785471 GGTGGGGTGCAGGGAGAGGATGG + Intronic
1191777043 X:64826024-64826046 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1192161387 X:68790728-68790750 GAGCGTGGGCAGAGAGAGAAAGG + Intergenic
1192529335 X:71872022-71872044 GAGGGTGAAAAGGGAGAGGAGGG + Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193350726 X:80462026-80462048 GAGGGTGGAAAGTGAGAGGAGGG - Intergenic
1193380367 X:80809900-80809922 AAGGGGGTGGAGAGAGGGGAGGG + Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193520506 X:82523816-82523838 AAGGTTGTGCAGAGAGACAAAGG + Intergenic
1193733384 X:85128275-85128297 GAGGATGTGGAGAAATAGGAAGG - Intergenic
1194257902 X:91656871-91656893 GAGGGTGTAGAGTGAGAGGAAGG - Intergenic
1194465446 X:94229609-94229631 GAGGGTGTAGGGTGAGAGGAAGG - Intergenic
1194700929 X:97112717-97112739 GAGGGAGTAAAGAGAGAGAATGG - Intronic
1194712515 X:97252901-97252923 GAGACTGTTCAGGGAGAGGAGGG + Intronic
1194772880 X:97926557-97926579 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1195416713 X:104628320-104628342 GAGGGGGAACAGAGAGAGGTTGG - Intronic
1195451196 X:105014943-105014965 GAGGATGTGGAGAAATAGGAAGG - Intronic
1195667848 X:107446848-107446870 GATGGGGTACAGAGAGAGCATGG - Intergenic
1195888791 X:109670611-109670633 GAGGGAGAGGAGGGAGAGGAGGG - Intronic
1195990297 X:110675757-110675779 GAGGGAGTGAGGAGGGAGGATGG + Exonic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196332210 X:114485685-114485707 GAGGGTGGGCGGGGTGAGGAGGG - Intergenic
1197113578 X:122804830-122804852 GAGGATGTGGAGAAATAGGAAGG + Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197634794 X:128902777-128902799 GGAGGTGGGCAGAGAGTGGAGGG + Intergenic
1197709487 X:129655226-129655248 GAGGGTTTGCAGAGACCTGAAGG + Intergenic
1197771511 X:130092349-130092371 CAGGGAGTGCAGAGAGGGAAGGG + Intronic
1197966140 X:132064049-132064071 GAGAGGGTGCAGTGAGAAGAAGG + Intergenic
1198136631 X:133758061-133758083 GAGGCTGTGGAGAAACAGGAAGG + Intronic
1198383422 X:136105258-136105280 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198383427 X:136105276-136105298 GAGGGAGGGAAGAAAGAGGAGGG + Intergenic
1198518909 X:137433227-137433249 GAGGGTGAGCCAAGACAGGATGG + Intergenic
1198556761 X:137802326-137802348 GAGGGTGGAGAGTGAGAGGAAGG - Intergenic
1198963164 X:142203812-142203834 GAGGATGTGGAGAAAGAAGAGGG + Exonic
1199264748 X:145817717-145817739 GAGGGAGTGAGGAGGGAGGAGGG - Intergenic
1199462825 X:148102416-148102438 GAGGGTGCAGAGTGAGAGGAGGG + Intergenic
1199680500 X:150221252-150221274 GATGCGGTGCAGAGAGAGGAGGG - Intergenic
1200576672 Y:4896451-4896473 GAGGGTGTAGAGTGAGAAGAAGG - Intergenic
1201146325 Y:11067197-11067219 GGGGGAGGGCAGGGAGAGGAAGG + Intergenic
1201167594 Y:11223960-11223982 GAGAGTGTGGAGAAATAGGAAGG - Intergenic
1201392600 Y:13514567-13514589 TGGGGTGGGCAGAGAGGGGAAGG - Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201540075 Y:15096536-15096558 AAGGGAGTCCAGAGAGAGGGAGG - Intergenic
1201549927 Y:15209215-15209237 AAGGGGGAGCAGGGAGAGGAGGG + Intergenic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1201920120 Y:19224973-19224995 GAGGATGTGGAGAAATAGGAAGG - Intergenic