ID: 925366283

View in Genome Browser
Species Human (GRCh38)
Location 2:3314267-3314289
Sequence CAGCTGGCATTAGCGGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925366283_925366287 0 Left 925366283 2:3314267-3314289 CCGGCTGCCGCTAATGCCAGCTG 0: 1
1: 0
2: 0
3: 7
4: 126
Right 925366287 2:3314290-3314312 CCACTCAGCCCCCTTTCCTGAGG 0: 1
1: 0
2: 3
3: 34
4: 308
925366283_925366288 5 Left 925366283 2:3314267-3314289 CCGGCTGCCGCTAATGCCAGCTG 0: 1
1: 0
2: 0
3: 7
4: 126
Right 925366288 2:3314295-3314317 CAGCCCCCTTTCCTGAGGCCAGG 0: 1
1: 0
2: 3
3: 34
4: 370
925366283_925366289 6 Left 925366283 2:3314267-3314289 CCGGCTGCCGCTAATGCCAGCTG 0: 1
1: 0
2: 0
3: 7
4: 126
Right 925366289 2:3314296-3314318 AGCCCCCTTTCCTGAGGCCAGGG 0: 1
1: 0
2: 3
3: 27
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925366283 Original CRISPR CAGCTGGCATTAGCGGCAGC CGG (reversed) Intronic
900564007 1:3323567-3323589 CAGCAGGCACTGGCGGCAGCTGG - Intronic
900613886 1:3555723-3555745 CTTCTGGCATGAGCGGCAGCAGG - Intronic
900868945 1:5288265-5288287 CAGCTGGCAAGAGCCACAGCTGG - Intergenic
901204372 1:7485404-7485426 CAGCTGCCTTTGGGGGCAGCTGG + Intronic
901296048 1:8161669-8161691 CAGGTGACATTAGCGAGAGCAGG - Intergenic
902258635 1:15207240-15207262 CAGCTGGCTTTAGTGGGAGGAGG - Intronic
902332221 1:15736211-15736233 CAGCTGGGATTGGTCGCAGCTGG + Intergenic
903018912 1:20379920-20379942 CAGCTGGCATTAGGGGCCAAGGG - Intergenic
903581373 1:24373363-24373385 CAGCTGCCATTAGGGGCCACTGG - Intronic
912841379 1:113042496-113042518 CAAGTGGCATTAGCAGCTGCAGG - Intergenic
914739932 1:150455939-150455961 TAGCTGGCACTACAGGCAGCTGG + Intronic
915559152 1:156676499-156676521 CCGCTGGCAGGAGCGGCTGCGGG - Exonic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
923759275 1:236825586-236825608 CAGCTGGCACTAGTGGCTGCTGG + Intronic
1067729724 10:48801567-48801589 CAGCTGCCATTTGGGACAGCTGG - Intronic
1069573614 10:69509090-69509112 CAGCTGCCTTTAGGGGCAGCAGG + Intergenic
1069945876 10:71985280-71985302 GAGCTGGGACTAGCGGCTGCAGG - Intronic
1070187046 10:74074330-74074352 CTGCTGGGATCAGGGGCAGCAGG + Intronic
1070786168 10:79163311-79163333 CAGCTGGGATTTCCTGCAGCAGG - Intronic
1073181073 10:101583597-101583619 GAGCGGGCATTTGCGGAAGCTGG - Exonic
1073248456 10:102107609-102107631 GAGCTGGGATAAGTGGCAGCAGG + Exonic
1074704888 10:116121831-116121853 CAGCTGGTACTAGCTGGAGCTGG - Intronic
1075686004 10:124365562-124365584 CAGCTGGCATTCTCAGCTGCTGG + Intergenic
1083742514 11:64718365-64718387 CAGCTGGCATGAGAGGATGCTGG - Intronic
1090424232 11:126595859-126595881 CTGCTGGCATAAGCAGCACCTGG + Intronic
1090428602 11:126627707-126627729 GAGATGGCATTGGCGGCAGGAGG + Intronic
1091617462 12:2060269-2060291 CAGCTGGCATTACCAGTAGCTGG + Intronic
1096390660 12:51226461-51226483 CAGCTGGAATTATAGGCATCAGG + Intergenic
1098991913 12:77072961-77072983 CTGATGGCAGTAGCAGCAGCTGG - Intergenic
1102563030 12:113776367-113776389 CAGCAGGCAATAGCTGTAGCCGG + Intergenic
1103339660 12:120214778-120214800 AAGCTGGAATGAGCGGAAGCGGG + Intronic
1103446370 12:120997580-120997602 CAGGTGGCATGAGCGGCTGCTGG - Exonic
1104282149 12:127387985-127388007 AAACTGACATTAGCTGCAGCTGG + Intergenic
1105623010 13:22087387-22087409 CTTCTTCCATTAGCGGCAGCAGG - Intergenic
1115645049 14:35363466-35363488 CAGCAGGCATTAGTGCCAGCTGG - Intergenic
1119531430 14:75364057-75364079 CAGCTGGCTTTAGGAACAGCTGG + Intergenic
1121219409 14:92274639-92274661 CAGCTGGCACTTGCAGCGGCTGG - Intergenic
1126851067 15:52797340-52797362 CAGCTGAGATTAGCTGCAGGTGG - Intergenic
1127142714 15:55993704-55993726 GAGCGGGCACTAGCGGCACCCGG + Intronic
1129174553 15:73830546-73830568 CAGCTGACATCTGCAGCAGCTGG - Intergenic
1129386400 15:75198469-75198491 CTGCTTGCTTTAGTGGCAGCGGG + Intronic
1133837073 16:9376935-9376957 TAGCTGGGATTAGAGGCAGGTGG + Intergenic
1137547010 16:49411419-49411441 CAGCTGGGATCAGCTTCAGCAGG + Intergenic
1140025805 16:71289360-71289382 CTGCCGGCATTCGCGGCTGCGGG - Exonic
1141049999 16:80752772-80752794 CAGCTGACATCAGCCACAGCGGG - Intronic
1144527188 17:16000013-16000035 CACCTGCCAGCAGCGGCAGCAGG - Exonic
1146844191 17:36173311-36173333 CAGCTGGCCTGAGCGGTGGCGGG - Intronic
1146856496 17:36261246-36261268 CAGCTGGCCTGAGCGGTGGCGGG - Intronic
1146864121 17:36327129-36327151 CAGCTGGCCTGAGCGGTGGCGGG + Intronic
1146872406 17:36385157-36385179 CAGCTGGCCTGAGCGGTGGCGGG - Intronic
1146879764 17:36436242-36436264 CAGCTGGCCTGAGCGGTGGCGGG - Intronic
1147008770 17:37426535-37426557 TAGCTGGGATTACAGGCAGCCGG - Intronic
1147066981 17:37927717-37927739 CAGCTGGCCTGAGCGGTGGCGGG + Intronic
1147075290 17:37985781-37985803 CAGCTGGCCTGAGCGGTGGCGGG - Intronic
1147078513 17:38007278-38007300 CAGCTGGCCTGAGCGGTGGCGGG + Intronic
1147086815 17:38065327-38065349 CAGCTGGCCTGAGCGGTGGCGGG - Intronic
1147094451 17:38131213-38131235 CAGCTGGCCTGAGCGGTGGCGGG + Intergenic
1147102760 17:38189290-38189312 CAGCTGGCCTGAGCGGTGGCGGG - Intergenic
1147648853 17:42050627-42050649 CAGCAGCCACTAGCGGCAACGGG + Intronic
1149847333 17:60015757-60015779 CAGCTGGCCTGAGCGGTGGCGGG - Intergenic
1150085692 17:62272374-62272396 CAGCTGGCCTGAGCGGTGGCGGG - Intergenic
1150143635 17:62750411-62750433 CAGGTGGCACTAGTGGCAGGAGG + Intronic
1156391258 18:36652637-36652659 GAGCTGGCATTCGAGACAGCAGG - Exonic
1158725621 18:59969239-59969261 GAGCTGGCATTATCTGGAGCAGG + Intergenic
1158796545 18:60853075-60853097 CAGCAGGCATCAGCTGGAGCTGG + Intergenic
1161867240 19:6842109-6842131 CAGCTGGGATTACAGGTAGCTGG - Intronic
1163187765 19:15651496-15651518 TAGCTGGGATTAGAGGCACCTGG + Intronic
1165257993 19:34591644-34591666 CAGCTGGAACAAGGGGCAGCAGG - Intergenic
1167622078 19:50566238-50566260 CAGCTGGGAGTAGCCGGAGCCGG - Intronic
1167728167 19:51233348-51233370 CAGCTGGAAGTACGGGCAGCAGG + Intronic
1168550182 19:57286515-57286537 TAGCTGGGATTAGAGGCATCTGG - Intronic
925366283 2:3314267-3314289 CAGCTGGCATTAGCGGCAGCCGG - Intronic
926306829 2:11643285-11643307 CTCCTGGCATGAGAGGCAGCAGG - Intergenic
926720433 2:15956397-15956419 CAGTTGGCGTGAGCTGCAGCAGG - Intergenic
936477025 2:112848290-112848312 CAGCTGGCCTGAGCTGCAGTAGG + Intergenic
937691889 2:124765823-124765845 CAGCTGGGATTACAGGCACCTGG - Intronic
941202065 2:162524409-162524431 CAGCTGGTATTTCCAGCAGCTGG + Intronic
946104695 2:217358845-217358867 CTGCTGGCCTCAGCGGCAACTGG - Intronic
946493434 2:220171977-220171999 CTGCTGGTATTGGGGGCAGCAGG - Intergenic
947528090 2:230891631-230891653 CAGCGGGCATCTGGGGCAGCTGG + Intergenic
1173665700 20:44761594-44761616 CAGCTGCCCTTAGTGGTAGCAGG + Intronic
1174637790 20:52016870-52016892 CAGGTGGCATTATCGGCGGGAGG + Intergenic
1177260714 21:18725745-18725767 GAGCTGGCACTGGCAGCAGCAGG - Intergenic
1180255357 21:46623530-46623552 CAGCTGGGATTACAGGCACCTGG - Intergenic
1181461007 22:23085948-23085970 CAGCGGGGATTAGCGCCTGCTGG - Intronic
1184072691 22:42155597-42155619 CAGGTGGCCTGAGGGGCAGCAGG + Intergenic
1184514082 22:44950417-44950439 CAGATGTCCTTAGCAGCAGCAGG + Intronic
949929036 3:9064046-9064068 CACAAGGCATTAGCGGGAGCAGG - Intronic
951752592 3:26054170-26054192 CAGCTGGGATTATAGGCACCGGG + Intergenic
953698541 3:45178793-45178815 CAGCTGGCTCTAAAGGCAGCGGG + Intergenic
955098982 3:55828453-55828475 TAGCTGGCAGCAGGGGCAGCAGG + Intronic
955118951 3:56036503-56036525 CAGCTGCCGTCAGCGGCACCAGG + Intronic
963583321 3:147154166-147154188 CAGCTGGCACTCGGAGCAGCTGG + Intergenic
968867841 4:3225188-3225210 CAGCCGGCAGGAGCGGGAGCAGG - Intronic
968920043 4:3517789-3517811 CAGAGGGCAGTGGCGGCAGCGGG - Intronic
969157608 4:5225274-5225296 TAGCTGGGATTATAGGCAGCTGG - Intronic
969586525 4:8097299-8097321 GAGGTGGCGTTAGCGGCAGAGGG + Intronic
973158672 4:46990451-46990473 CAGCTTGCATTATAGCCAGCTGG + Intronic
974433492 4:61828742-61828764 CACCTGGCATCAGCAACAGCTGG + Intronic
977908375 4:102501947-102501969 CACATGGGATTAGCGACAGCGGG + Intronic
980098911 4:128521814-128521836 CAGATGGCATTAGCGTCACTAGG + Intergenic
983457758 4:167985974-167985996 CAGGTGGCAGTAGTAGCAGCAGG + Intergenic
986220752 5:5766806-5766828 CGACAGGCATTAGTGGCAGCAGG + Intergenic
987090838 5:14506817-14506839 CACCTGGCACTGCCGGCAGCCGG + Intronic
992923481 5:81553683-81553705 CAGCAGGAAATAGAGGCAGCAGG + Intronic
993021776 5:82600651-82600673 CAGCTGGGATTAGGTTCAGCTGG + Intergenic
1005839252 6:29730681-29730703 CAGTGGGCATGAGAGGCAGCAGG - Intronic
1006151467 6:31992366-31992388 CAGCTGGCAGGGGCGGCAGGTGG - Exonic
1006157768 6:32025104-32025126 CAGCTGGCAGGGGCGGCAGGTGG - Exonic
1006516072 6:34546443-34546465 CAGCTGGCATTTGCTTCTGCAGG + Intronic
1011046836 6:83093773-83093795 CAGCTGGGATTACAGGCACCTGG - Intronic
1017032767 6:150238591-150238613 CATATGGCATGAGCTGCAGCTGG - Intronic
1017436217 6:154418082-154418104 CAGCTGACATTCCCAGCAGCGGG - Intronic
1022092280 7:27115546-27115568 GAGCTGGCCTTCCCGGCAGCTGG - Intronic
1022488676 7:30800094-30800116 CAGCTGACATTGACAGCAGCTGG + Intronic
1023202659 7:37715747-37715769 CAGCAGGTATTAGCGTCAGGAGG + Intronic
1026706795 7:72700931-72700953 CAGCTGGGATTAGAGGCATGTGG - Intronic
1026962637 7:74418242-74418264 CAGCTGGAAATTGTGGCAGCGGG - Intergenic
1028481810 7:91314352-91314374 GAGCTGGCCCTAGGGGCAGCTGG - Intergenic
1029229174 7:99052168-99052190 CAGATGGCATTGGCCACAGCAGG + Intronic
1031428303 7:121635025-121635047 TAGAAGGCATTAGCAGCAGCAGG - Intergenic
1035585208 8:767485-767507 TAGCTGGGATTAGAGGCACCTGG + Intergenic
1041593980 8:59624432-59624454 CAGCAGGCATTAGCATCACCTGG + Intergenic
1042178238 8:66058785-66058807 CAGCTGTCATTTGAGGTAGCTGG - Intronic
1053144585 9:35703961-35703983 CAGCCGGAATTAGGGGCATCAGG + Intronic
1053179427 9:35955772-35955794 CAGCTGGGATTACAGGCACCTGG - Intergenic
1055580961 9:77705786-77705808 CTGCTGGCATGAGTGGGAGCTGG + Intergenic
1056798132 9:89673360-89673382 CATCTGGCAGCAGGGGCAGCAGG + Intergenic
1061300481 9:129701968-129701990 TAGCTGGCATTACAGGCACCCGG - Intronic
1062522862 9:136965787-136965809 AAGCTGCCAGTAGCTGCAGCTGG + Intergenic
1189102506 X:38206117-38206139 AAGCTGGCATTACATGCAGCTGG - Intronic
1198201988 X:134430861-134430883 TAGCTGGGATTACAGGCAGCTGG + Intergenic
1199978141 X:152906170-152906192 CAGCAGGCATGAGCCCCAGCAGG + Intergenic
1201539441 Y:15090350-15090372 CAGCTGACATCAGAGGAAGCTGG + Intergenic