ID: 925367553

View in Genome Browser
Species Human (GRCh38)
Location 2:3321111-3321133
Sequence AGAGCTCTCCCTGGGCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925367553_925367560 8 Left 925367553 2:3321111-3321133 CCTCCCGGCCCAGGGAGAGCTCT 0: 1
1: 0
2: 3
3: 16
4: 237
Right 925367560 2:3321142-3321164 TGCTCCAAACGACAGCTCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925367553 Original CRISPR AGAGCTCTCCCTGGGCCGGG AGG (reversed) Intronic
900799200 1:4727131-4727153 ACAGCTCTCACTGTGCCAGGCGG + Intronic
901669731 1:10849257-10849279 GGAGCTCTGCCTGGTCCGGGTGG - Intergenic
902372028 1:16013246-16013268 CGAGCCCTCCCTCGGCCGGCCGG - Intergenic
903831914 1:26180571-26180593 GGAGCTCATCCTGGGCGGGGTGG + Exonic
905455117 1:38083343-38083365 AGAGCTATCCCTGAGCAGTGTGG + Intergenic
905546537 1:38804502-38804524 AGAGATCTGGCTGGGCCGTGCGG - Intergenic
906306725 1:44724457-44724479 GGAGCGCTCCGTGCGCCGGGTGG + Intronic
914430105 1:147613049-147613071 AAAGCACTCCCTGGCCCAGGTGG + Exonic
916773595 1:167936891-167936913 ATGGCTCTGCCTGAGCCGGGTGG - Exonic
917223127 1:172752985-172753007 AGTGCTCTTCCTGGGGCGGGGGG - Intergenic
918392635 1:184082476-184082498 GGAGCTTTACCTGGGCCTGGAGG + Intergenic
920661865 1:207922365-207922387 AGAACTCTACCAGGGCCAGGTGG - Intergenic
921932848 1:220769377-220769399 TGAGATCTGCCTGGGCCGGTGGG + Intronic
922335695 1:224616771-224616793 AGAGCTCTTCCTGGGGCGAATGG + Exonic
923063447 1:230497569-230497591 AGAGCTCTCCCTGGGGGAGGAGG + Intergenic
924383430 1:243483235-243483257 AGCGCGCCCCCTGGGCTGGGCGG + Intronic
924795999 1:247292553-247292575 AGAGCCCTCCTTTGGCCAGGGGG - Intergenic
1063970392 10:11377737-11377759 AGAGCTCTCACTCGGCCTGTAGG + Intergenic
1065793879 10:29288825-29288847 AGAGCTCTCACTTGGACAGGAGG + Intergenic
1065948670 10:30629976-30629998 AGAGCTCTCACTTGGACGGGAGG - Intergenic
1067166473 10:43869735-43869757 AGACCTCTCCCTGAGTCAGGTGG + Intergenic
1067385874 10:45817428-45817450 AGCCCTCTCCCTGGACTGGGAGG - Exonic
1067853196 10:49768565-49768587 TGAGCTCGCCCTGGGTCGAGAGG - Intergenic
1068338314 10:55667308-55667330 TGTGCTCTCCCTGGGGCTGGTGG + Intergenic
1068497658 10:57805705-57805727 AATGCTCTCCCTGGGAGGGGAGG - Intergenic
1069659099 10:70111800-70111822 AGAGGGCTCCCTGCGCCGGCAGG - Exonic
1073107247 10:101039226-101039248 AGTGCTGTCCCTGGGCTGGGTGG + Intronic
1075068139 10:119303484-119303506 AAGGGTCTCCATGGGCCGGGAGG + Intronic
1076143105 10:128095495-128095517 AGAGCTCCCCCTGGGAGGTGGGG + Intergenic
1076159797 10:128234933-128234955 AGGGCTCTCCCTGGGGCTGCAGG + Intergenic
1076618367 10:131771426-131771448 TGAGCTCTCCAGGGGCCTGGTGG - Intergenic
1076739760 10:132477443-132477465 AAAGCCTTCCCTGGGCCAGGCGG + Intergenic
1076881626 10:133242254-133242276 AGAGCCTTCCCTGGGCCTGAGGG - Intergenic
1077020929 11:416896-416918 CGAGCTCGCCCGGCGCCGGGTGG - Intronic
1077116006 11:884934-884956 CCAGCTCTCCCTGGGCCAGGCGG - Intronic
1077409105 11:2395306-2395328 CAGGCTCTCCCTGGGCAGGGTGG - Intronic
1077415360 11:2422110-2422132 GGAGCGCTGCCTGTGCCGGGTGG + Intronic
1077611577 11:3646215-3646237 ATTGCTCTCCCTGGGCAGGCAGG + Intronic
1078619388 11:12893378-12893400 AGAGTGTGCCCTGGGCCGGGAGG - Intronic
1080540550 11:33259800-33259822 AGAGATCCCCTTGGGGCGGGGGG - Intronic
1081991134 11:47338249-47338271 AGAGCCATCCCTGTGCCTGGGGG - Intronic
1083484517 11:62975053-62975075 TGAGCTCTCCCCGGGCTGTGTGG + Intronic
1083609529 11:63998440-63998462 AGAGCTCTCGGTGAGCCAGGCGG - Intronic
1084195795 11:67523192-67523214 AGAGCCCTCCGAGGGCCGGGCGG - Intronic
1084473211 11:69375036-69375058 AGGGCTCGCCCTGGGCCTGAGGG + Intergenic
1087659994 11:100976156-100976178 AGATTTCTCCCTGGGCTGGCAGG - Exonic
1087906457 11:103703393-103703415 AGAGCTGGCCCTGGGCCTGGTGG - Intergenic
1089630434 11:119781012-119781034 AGTGACCTCCCTGGGCCGGTTGG + Intergenic
1089920979 11:122209335-122209357 AGAGATCTACCTGGGCCCAGGGG - Intergenic
1091601878 12:1922637-1922659 AGTGCTCTCCCTGCCCTGGGGGG - Intergenic
1092229453 12:6768513-6768535 TGAGATCACCCTGGGCGGGGGGG - Intronic
1101642883 12:106601289-106601311 AGAGCCCACCCTGGTGCGGGAGG + Exonic
1102465785 12:113130177-113130199 AGAGCTGTCCCTCGGCCTGCGGG + Intronic
1102594486 12:113982022-113982044 AGAGCCCTGGCTGGGCCTGGGGG + Intergenic
1104439991 12:128786707-128786729 AGCAGTCTCCCTGGGCCAGGAGG - Intergenic
1104921744 12:132294203-132294225 AGAGCTGTCCCTGGAGCAGGTGG + Intronic
1119425414 14:74531761-74531783 AGGGCTTTCCCTGGGCCGGGAGG - Intronic
1121013753 14:90536108-90536130 AGAGCTGACCGTGGGCCTGGTGG - Exonic
1121334243 14:93067371-93067393 AGAGCTCTGCCAGGGCAGGTGGG - Intronic
1121547858 14:94775478-94775500 AGAGCCCTCCCTGGGCTGCCAGG + Intergenic
1122369793 14:101223195-101223217 AGGGCTCTCCTTGGGGCTGGGGG - Intergenic
1122793509 14:104194342-104194364 AGAGCTGTCCCTCGTCCTGGAGG + Intergenic
1124006798 15:25801222-25801244 TCAGCTCTCCCTGGGCCTCGAGG - Intronic
1124150055 15:27169323-27169345 AGAGCACTTCCTGGGGAGGGAGG + Intronic
1128215406 15:65930934-65930956 AGACCTCTCCCTGGAAAGGGAGG + Exonic
1129334681 15:74844918-74844940 CCAGCTCTCCCTGGAACGGGAGG - Exonic
1129364073 15:75043726-75043748 CCAGCTCTGCCTGGGCCGGGAGG - Intronic
1129774781 15:78229666-78229688 ACAGCCCTCCCTGGGCCAGATGG + Intronic
1131038929 15:89244267-89244289 AGAGCTCACCCTCGGCCAAGGGG - Intronic
1131828674 15:96340909-96340931 TTAGCTCTCCCTGGGCCGCGAGG + Intergenic
1132065080 15:98724449-98724471 AGAGCTCTCACTGGGGCTGCTGG - Intronic
1132473241 16:118783-118805 GTGGCTCTCCCTGGGCCGGCAGG - Intronic
1132473336 16:119101-119123 ATGGCTCTCCCTGGGCAGGTGGG - Intronic
1132543351 16:521651-521673 CGCTCTCTCCCTGGGCAGGGTGG + Exonic
1132608189 16:802166-802188 AGGGCTCTCCCTGTGGCTGGGGG + Intergenic
1132608471 16:803310-803332 ATAGCTGTCCCTGGCCCGAGGGG + Intergenic
1135397394 16:22141725-22141747 ACAGCTCCCCCAGGGCCAGGGGG - Intronic
1136365060 16:29806097-29806119 CGCGCTCACCCTGGGGCGGGAGG - Intronic
1137444502 16:48523528-48523550 AGAGCTCGCCCCAGGCCTGGTGG - Intergenic
1138303654 16:55955119-55955141 TGAGCTCTCCCTGGGGCAGAAGG - Intronic
1138590921 16:57999463-57999485 AGAGATTTGCCTGGGCTGGGTGG - Intronic
1139841249 16:69882626-69882648 AGTGCTTTCCCTGGGCCGCAGGG + Intronic
1141464673 16:84197667-84197689 AGTGCTTTCCCTGGGCCGCCCGG + Intergenic
1142201270 16:88762200-88762222 TGAGCTCTGGGTGGGCCGGGAGG - Intronic
1144639580 17:16930238-16930260 AGGGCTGTCCCTGGGAGGGGCGG - Intronic
1144712984 17:17414565-17414587 ACAGCTCTCCCTGGGGCTGTGGG + Intergenic
1144759215 17:17697993-17698015 AGTGCTCACCCAGGGCCGGATGG - Intronic
1144849206 17:18235586-18235608 AGAGCCCATCCTGGGCCTGGTGG + Intronic
1145170556 17:20652633-20652655 AGACACATCCCTGGGCCGGGAGG - Intergenic
1148160518 17:45447325-45447347 TGGGCTGTCCCTGGGCTGGGGGG - Intronic
1149480159 17:56996804-56996826 AGAGCTTTGGCTGGGCCTGGTGG - Intronic
1149563497 17:57626050-57626072 AGGGCTCTTCCTGGGGCTGGAGG - Intronic
1151657253 17:75501862-75501884 AGACCTGGCCCTGGGCAGGGCGG + Exonic
1151911884 17:77088845-77088867 AGAGCTCTGCCGGGGGCTGGAGG + Exonic
1151989360 17:77564381-77564403 AGGGATCTCCCTGGCTCGGGCGG - Intergenic
1152017549 17:77761535-77761557 AGAGCCCTGCATGGGCCTGGGGG + Intergenic
1152304103 17:79511203-79511225 GGGACTCTCCCTGGGCCAGGAGG + Intronic
1156514765 18:37670412-37670434 GGAGCTCTCCTTAGGCTGGGAGG + Intergenic
1158953782 18:62522303-62522325 AGCGCTCACCCTCGGCCGGCCGG + Intergenic
1159475039 18:68910539-68910561 TGAGAACTCCCTGGGCCAGGAGG + Intronic
1160143725 18:76347894-76347916 ACGGCTCTCACTGGGCCGGCTGG - Intergenic
1160456610 18:79006384-79006406 AGTGCTCGCCCTGGGCCCCGAGG - Intergenic
1162424628 19:10587095-10587117 AGACCTCTTCCTGGCCCGCGCGG + Intronic
1162895580 19:13763154-13763176 TGAGCTCTCCCAGGGCTGGTGGG - Exonic
1163172867 19:15544766-15544788 AAAGCTTTGCTTGGGCCGGGTGG + Intronic
1166523685 19:43497798-43497820 CGAGCTGTCCCTGGGCCTTGCGG + Exonic
1166747009 19:45146219-45146241 GGAGCTCTTCCTGGGGTGGGGGG + Intronic
1167768350 19:51499138-51499160 AGTCCTCTCCCTGGGGCTGGAGG - Intronic
1168100636 19:54139153-54139175 AGAGCTCACCCCGGGGTGGGTGG - Intronic
925027246 2:619892-619914 AGAGGCCTCTCTGGGCAGGGTGG + Intergenic
925367553 2:3321111-3321133 AGAGCTCTCCCTGGGCCGGGAGG - Intronic
925895689 2:8470284-8470306 GGAGCCCTCCCTGTACCGGGAGG + Intergenic
926004842 2:9365681-9365703 AGAGCAGTCCCTTGGCCAGGAGG - Intronic
926151311 2:10427090-10427112 TGAGCTCCCCGTGAGCCGGGAGG - Exonic
926312046 2:11682006-11682028 AGAGCCCTCCCAGGACCAGGGGG - Intronic
926907132 2:17816439-17816461 AGAGCTCTTCCCTGGCCAGGCGG + Intergenic
927152511 2:20204053-20204075 TGTGGTCTCCCTGGGTCGGGGGG + Exonic
927934668 2:27069649-27069671 ACTGCTCTCCCTGGTCCGGGGGG - Exonic
928362737 2:30678770-30678792 AGATCTCTCCCTGGGTCTGTAGG + Intergenic
929329180 2:40659106-40659128 AGAGCTCTCCATGGTCCTGCTGG - Intergenic
929437748 2:41941010-41941032 GGATCTCTCCCTTGGCCCGGAGG - Intronic
932403859 2:71500607-71500629 GGAATTCTCCCTGGGCTGGGAGG + Intronic
932855950 2:75234160-75234182 AGGGCTCTCCCTGTCCCTGGTGG + Intergenic
934616484 2:95774539-95774561 AGAGCTCCCACTGTGCCAGGAGG - Intergenic
934644409 2:96050021-96050043 AGAGCTCCCACTGTGCCAGGAGG + Intergenic
934670246 2:96208109-96208131 CGAGCTCTTTCTGGGCCGTGGGG - Intronic
934697967 2:96413872-96413894 AGAGCTATCCCTGCGCCTGCAGG - Intergenic
934837825 2:97606111-97606133 AGAGCTCCCACTGTGCCAGGAGG + Intergenic
935214858 2:100967942-100967964 ACAGCTCTGCCTGCGGCGGGAGG + Intronic
936165182 2:110114757-110114779 AGTGCTGTCCCTGAGCAGGGGGG - Intronic
937854395 2:126661876-126661898 AGAGCCAGCCCTGGGCAGGGTGG + Intronic
938274757 2:130008461-130008483 AGATTTCTCCCTGGGCTGGCAGG - Intergenic
938342361 2:130544166-130544188 TGTGCTCTCCCTGGGCCAGCAGG - Intronic
938347471 2:130576543-130576565 TGTGCTCTCCCTGGGCCAGCAGG + Intronic
938440612 2:131328817-131328839 AGATTTCTCCCTGGGCTGGCAGG + Intronic
945028639 2:205643132-205643154 GGAGCTCTCCCTGCACTGGGAGG - Intergenic
946034701 2:216732436-216732458 AGAGCTGTACCTGGGAAGGGGGG + Intergenic
946392516 2:219425307-219425329 AGGGCTCTCCTGGGGCCTGGGGG + Intronic
946397609 2:219451266-219451288 GGAGCTCACCTTGGGGCGGGGGG - Exonic
949051231 2:241898672-241898694 TCAGCTCTCCCTGGGACGCGTGG + Intronic
949059645 2:241949479-241949501 TGAGCCCTCCCTGGGCCGGGTGG + Intergenic
1169636859 20:7702054-7702076 AGAGCTCTCCCTCTGTTGGGGGG - Intergenic
1170214308 20:13875581-13875603 AGAGCTCCCTCTGGCCCAGGCGG - Intronic
1173135254 20:40433543-40433565 AGAGCTCAGCCTGGGCTGTGGGG + Intergenic
1173555117 20:43960483-43960505 AGAGCTCCCCTTGGGACAGGTGG + Intronic
1173576814 20:44117362-44117384 AGATCTCTACCAAGGCCGGGAGG + Intronic
1174041693 20:47704953-47704975 ACAGCTCCCCCAGGGCCAGGTGG - Intronic
1175882699 20:62270071-62270093 CGCGCTCTGCCTGGGCCGCGAGG - Intronic
1176141233 20:63545982-63546004 AGGTCTCTCCCTGGGGCGTGGGG + Intronic
1176546847 21:8205924-8205946 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1176554752 21:8250133-8250155 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1176565798 21:8388971-8388993 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1176573673 21:8433158-8433180 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1177168823 21:17633142-17633164 AGAGCTCTCCCTGTGCCTGGGGG - Intergenic
1178915890 21:36705419-36705441 CCAGCTCCCCCTGGGGCGGGTGG + Intronic
1179483864 21:41696596-41696618 AGAGCTCTCCCTTGTCCTCGTGG - Intergenic
1179567361 21:42257764-42257786 AGAGGTCTCCCTGCACCGCGAGG + Intronic
1179655916 21:42844714-42844736 GAAGCTCTCCCTGGGGCAGGAGG + Intronic
1179994913 21:44969554-44969576 AGAGCTCCCCCAGGGTCAGGAGG - Intronic
1181060029 22:20277995-20278017 AGAGCTCTTCCTGGTGCTGGGGG + Intronic
1181548087 22:23616056-23616078 AGAGCTCTTCCTGGGCATGGAGG - Intronic
1182287802 22:29258604-29258626 AGTGCTCTCCTTGGGCTGGGGGG + Intronic
1183463660 22:37968253-37968275 AGGGCTCTGCCTGGGGAGGGTGG - Exonic
1183512258 22:38243202-38243224 GGACCTCTCCCCGGGCAGGGAGG + Intronic
1183654594 22:39177288-39177310 AGGGGTCTTCCAGGGCCGGGAGG + Intergenic
1183709260 22:39492780-39492802 GGAGCTTCCTCTGGGCCGGGTGG + Intergenic
1184501746 22:44878819-44878841 AGAGCTGTCCCTGGGAGGGAGGG + Intergenic
1184710551 22:46247037-46247059 GGAGCTCTCCCTGGGTAGGGAGG - Intronic
1185112249 22:48906601-48906623 GGAGGTGTCCCTGGGCCTGGGGG + Intergenic
1203251722 22_KI270733v1_random:122209-122231 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1203259772 22_KI270733v1_random:167291-167313 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
953684595 3:45066774-45066796 AGAGCCCTCCCTGTGCTTGGGGG + Intergenic
954533664 3:51341962-51341984 AGAGCTCTCCCAGAGATGGGAGG - Intronic
954638279 3:52083438-52083460 AGCGCTCTCCCTGGGCTACGTGG + Intronic
959358923 3:105366605-105366627 AGGGCTCTCCCTGGCGCGCGCGG + Intergenic
960587510 3:119334121-119334143 AGAGGTCTCACTGTGCCTGGGGG - Intronic
960962059 3:123078315-123078337 AGAGCAAGCGCTGGGCCGGGAGG + Intronic
961099560 3:124186996-124187018 AGAGCTCACCTTGGTGCGGGTGG + Intronic
961258309 3:125577538-125577560 AGAACTCTCGCTGGGCGTGGTGG + Intronic
961452586 3:127009077-127009099 CCAGCTCTCCCTGGCCCGAGAGG - Intronic
961455016 3:127019741-127019763 AGAGCTGGCCCTGAGCAGGGTGG + Intronic
961484351 3:127206805-127206827 ACACCTCGCCCTGGGCCTGGGGG + Intergenic
961601975 3:128069416-128069438 AGAGCTCCCCGTGAGCCAGGCGG - Intronic
961743076 3:129046183-129046205 CCAGCGCGCCCTGGGCCGGGAGG - Intergenic
966768063 3:183479974-183479996 AGAGCTCCCTCTGGGAGGGGAGG + Intergenic
967811835 3:193767060-193767082 ACAGCTCTTCCTGGACAGGGGGG + Intergenic
968026013 3:195443041-195443063 AGCGCTCTACTTGGGGCGGGAGG - Exonic
969209602 4:5676735-5676757 AGAGAACTCCATGGGCTGGGTGG - Intronic
969292919 4:6252227-6252249 GGAGCTCTGCCTGGGGCAGGAGG - Intergenic
969568201 4:7992617-7992639 TGAGCTCTCCCTGGGGTCGGGGG + Intronic
969859030 4:10021332-10021354 AGTGCCCTCCCTGGCCCTGGAGG + Exonic
973334125 4:48938658-48938680 ACAGCTCTGCCTGGGCAGGCAGG + Intergenic
985445865 4:190021120-190021142 AGAGCTCCGCCTGGGCTGGTTGG + Intergenic
985576043 5:673904-673926 AGAACTCTCCCTGCGGTGGGTGG - Intronic
985745647 5:1645328-1645350 AGAGCTCTGTCGGGGCCGGACGG + Intergenic
985748164 5:1659537-1659559 AGCCCTCTCCCGGGGCAGGGAGG + Intergenic
992130020 5:73682753-73682775 AGAGCTCTGGCTGGGCATGGTGG + Intronic
992259640 5:74956902-74956924 AGAGCTCTGGCTGGGCCCGGTGG + Intergenic
996028913 5:118683586-118683608 AGAGTTGTCCCTGGGCCAGGAGG + Intergenic
999127652 5:149258293-149258315 AGAACTCTTCCTGGGACAGGTGG - Exonic
1002521518 5:179795433-179795455 AGAGGTCTCCTCGGGCGGGGAGG + Intronic
1002619058 5:180474029-180474051 AGAGCTCTGGCTGGGCACGGTGG + Intergenic
1003149684 6:3538155-3538177 AGAGCTGCCCCTGGGGCTGGGGG - Intergenic
1004690233 6:17987305-17987327 AGAGCGCGGCCGGGGCCGGGGGG - Intronic
1005875164 6:30006059-30006081 GGAGCTCTCCCTGGGAATGGAGG - Intergenic
1005969301 6:30748948-30748970 AAAGGTCTCTCTGTGCCGGGAGG - Intergenic
1006114389 6:31767494-31767516 AGGGGTCTCCCAGGGCCAGGAGG - Exonic
1006523418 6:34585276-34585298 AGAGCTCTCCCAGGCCGGGCTGG + Intergenic
1006899907 6:37493271-37493293 CCAGCTGTCCCTGGGCCGGAAGG + Intronic
1007449404 6:41931636-41931658 CTAGCTGTCCCTGGGCTGGGTGG + Intronic
1007747439 6:44051616-44051638 AGGCCTCTCCCTGGGTCTGGTGG - Intergenic
1012436835 6:99223898-99223920 ACAGCTCTCTCTGGGCAGTGGGG + Intergenic
1012530452 6:100229211-100229233 AAAGGTCTCCCCGGGCCCGGAGG - Intergenic
1015603427 6:134932859-134932881 AAAGCTCTCCCTGGAGCTGGGGG - Exonic
1017749688 6:157479805-157479827 CCAGCTCTCTCTGGGCCAGGAGG - Intronic
1018864092 6:167734296-167734318 AGACCTCTCCGTGCCCCGGGAGG + Intergenic
1019152730 6:170019595-170019617 AGAGCCCGCCCTGGGCGTGGGGG - Intergenic
1019472305 7:1227490-1227512 ACAGGTCTCCCAGGGCGGGGAGG - Intergenic
1019701860 7:2477990-2478012 AGGGCTGTCCCTGGGGCTGGGGG - Intergenic
1019743693 7:2688205-2688227 GCAGCTCGGCCTGGGCCGGGAGG - Intronic
1020115857 7:5476028-5476050 AGACCTTTCCCTGGACCTGGGGG - Intronic
1020167439 7:5818928-5818950 AGTGCTCTAGCTGGGCCTGGTGG - Intergenic
1020271672 7:6600283-6600305 TGAGCTCTCGCTGGACCGGCTGG + Exonic
1021781089 7:24106812-24106834 AGTGGTCGCCCTGGGCTGGGAGG - Intergenic
1029001477 7:97159504-97159526 AGAACTCTCCCTGTGCTGAGGGG - Intronic
1029221533 7:98994481-98994503 AGAGATGACCCTGGGCTGGGAGG + Intronic
1029339997 7:99934839-99934861 ACAGTTCTCCCTGGGCCTGACGG - Intergenic
1034293409 7:149949976-149949998 AGTGCACTCCCTGGACAGGGAGG + Intergenic
1034533460 7:151712202-151712224 AGAGCTCTCAGAGGGTCGGGCGG - Intronic
1034812657 7:154146877-154146899 AGTGCACTCCCTGGACAGGGAGG - Intronic
1035169512 7:157009876-157009898 AGAGCGCCGCCTGCGCCGGGAGG + Exonic
1036656205 8:10679034-10679056 AGGGCTCAGCCTGGGCCTGGAGG - Intronic
1037825213 8:22156551-22156573 CGATCTCTCCCTGGGGCCGGCGG + Exonic
1049569212 8:143360567-143360589 AGAGCTCCCTCTCGGCCTGGAGG - Intergenic
1049796234 8:144498447-144498469 GGAGCTCTTCCTGGGCTGGAGGG + Intronic
1053175273 9:35917877-35917899 AGAGCTCTCTGGCGGCCGGGTGG - Intergenic
1056062503 9:82898073-82898095 TGAGCTGTCCATGGGCTGGGGGG + Intergenic
1057840330 9:98481102-98481124 AGAGCTCTGCCTGGGAAGGTGGG + Intronic
1058887267 9:109330888-109330910 AGAGCTCTACCAGGGCAGGCAGG - Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060734449 9:126057699-126057721 AGCGGCCTCCCTGGGCCCGGCGG + Intergenic
1061217707 9:129231420-129231442 AGAGCTGTGCCGGGGCCGAGCGG - Intergenic
1061733669 9:132637147-132637169 GGACCTCTCCCTGGGTAGGGCGG - Intronic
1062102793 9:134737314-134737336 AGAGCTGCCCCTGGGCCTGCTGG + Intronic
1062303620 9:135889663-135889685 AGAGACCTCACTGGGCCAGGAGG + Intronic
1062471948 9:136710001-136710023 AGGGCTGTCCCAGGGCCAGGGGG - Intergenic
1203468124 Un_GL000220v1:105360-105382 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1203475945 Un_GL000220v1:149332-149354 ATACCTCCCCCGGGGCCGGGAGG - Intergenic
1186496576 X:10015979-10016001 CGAGCTCTGCCCGGGCCCGGGGG - Intronic
1187697046 X:21933294-21933316 GCAGCTCTGCCTGGGCCAGGGGG + Intergenic
1188669728 X:32868389-32868411 TGAGCTCTCCCGGGGAGGGGCGG + Intronic
1189278385 X:39803839-39803861 AGGGCACTCCCTGGGCAAGGTGG + Intergenic
1193920981 X:87425550-87425572 CGTGCTCTCCCTGGGGCTGGTGG + Intergenic
1196736528 X:118985518-118985540 AGGCCTCTCCCTGGGCCCTGGGG + Intronic
1196793566 X:119485282-119485304 AGAGCAATCACTGGGCGGGGTGG + Intergenic
1200093697 X:153647543-153647565 AGATCTCCCCCAGGGCCAGGTGG - Intronic
1200226315 X:154419778-154419800 AGGGCCATCTCTGGGCCGGGAGG - Intronic