ID: 925371913

View in Genome Browser
Species Human (GRCh38)
Location 2:3351942-3351964
Sequence GACTCACGTTTCGGGTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925371913 Original CRISPR GACTCACGTTTCGGGTGGGA TGG (reversed) Intronic
900102943 1:970588-970610 GACTCACATTTCAGGTGAGGCGG + Exonic
907065936 1:51483089-51483111 GATTCACGTCCTGGGTGGGATGG - Intronic
914246783 1:145892158-145892180 GTCTCAGGTTTCAGGGGGGATGG + Exonic
917464715 1:175265971-175265993 GACTCATGTCCTGGGTGGGATGG + Intergenic
1065268343 10:24000471-24000493 GACTCACGTTTCCGCAGGGCTGG - Intronic
1070022353 10:72599437-72599459 GATTCATGTTCCAGGTGGGATGG - Intronic
1070836617 10:79451281-79451303 GATTCACGTCCCGGGTGGAACGG + Intergenic
1076219017 10:128718098-128718120 GACACAGGTTTTGGGTGGGGTGG + Intergenic
1076701226 10:132274311-132274333 GACCCACATTTGGTGTGGGATGG - Intronic
1079146333 11:17855574-17855596 GATTCATGTTCTGGGTGGGATGG + Intronic
1083625063 11:64068166-64068188 GACTCACGCTTCGGGAGTGTTGG + Intronic
1084552563 11:69854874-69854896 GACTCATGTCCCGGGTGGGATGG - Intergenic
1090726023 11:129528004-129528026 GATTCACATCCCGGGTGGGATGG + Intergenic
1096880138 12:54660687-54660709 GATTCACATCCCGGGTGGGATGG - Intergenic
1097933033 12:65212045-65212067 GACTCACAGTTCGGCTGGGGAGG + Intronic
1098543295 12:71683835-71683857 GATTCACGTCCCAGGTGGGATGG + Intronic
1107817591 13:44257954-44257976 GATTCACGTTCCTGGGGGGATGG - Intergenic
1112843223 13:103606103-103606125 GACTCATGTCGCCGGTGGGAGGG - Intergenic
1113190728 13:107742594-107742616 GACTCACATTTCTGTAGGGATGG - Intronic
1114524573 14:23359798-23359820 GACGCTCGTTTCAGGTTGGAGGG + Exonic
1122203411 14:100136206-100136228 GACTCAGGGTCCTGGTGGGAAGG - Intronic
1129018001 15:72486318-72486340 GATTCACGTCCTGGGTGGGATGG - Intronic
1135389807 16:22081520-22081542 GACACATGTTTTGGGTGGGTGGG + Exonic
1136628470 16:31476170-31476192 GGCTCACGTGTCGGATGGGCTGG - Exonic
1137735157 16:50718388-50718410 GATTCACGTCCTGGGTGGGATGG + Intronic
1141611097 16:85181634-85181656 GTCTCCCGCTTCGGGTGGGAAGG + Intronic
1144027943 17:11295079-11295101 GATTCACGTCCCGGGTGGGTGGG + Intronic
1145783077 17:27576645-27576667 AATTCACGTCTCCGGTGGGATGG + Intronic
1145894594 17:28446895-28446917 GACTCATGTCCCAGGTGGGATGG - Intergenic
1147420632 17:40320597-40320619 GACTCCAGTCTCAGGTGGGATGG + Intronic
1149107824 17:52990601-52990623 GACTCACGTTTTGGGGCAGAAGG - Intergenic
1159620897 18:70637145-70637167 GACTCATGTCCCAGGTGGGATGG - Intronic
1164191718 19:22924114-22924136 GACTCTTTTTTTGGGTGGGAAGG + Intergenic
925371913 2:3351942-3351964 GACTCACGTTTCGGGTGGGATGG - Intronic
926101437 2:10120731-10120753 GACTCAGGTTTAGCGCGGGAGGG + Intergenic
929305947 2:40361736-40361758 GCCACACGTATCGGGTAGGAAGG + Intronic
936574484 2:113641873-113641895 GGTCCACATTTCGGGTGGGATGG + Intronic
937025336 2:118692928-118692950 GACTCACACGTCGGGTGGTATGG - Intergenic
937737482 2:125310081-125310103 GGCTCACATTTAGGGTGGCAAGG + Intergenic
944085471 2:195842709-195842731 CACTCACATTTTGGGAGGGATGG - Intronic
946251507 2:218416735-218416757 GACTCACGTTTCAGGTGGGATGG - Intergenic
946843111 2:223837309-223837331 GACGCACGGTTCGGGTGGCCAGG + Intronic
1172070801 20:32255449-32255471 GACTCACGTTTCTGGTGCCTGGG + Intergenic
1178370757 21:32025451-32025473 GATTCACATCTCAGGTGGGATGG - Intronic
1178550735 21:33536794-33536816 GATTCACGTCTCAGGTTGGACGG + Intronic
1181437421 22:22918795-22918817 GTCTCTCTTTTTGGGTGGGATGG - Intergenic
1185425686 22:50769010-50769032 GGTCCACATTTCGGGTGGGATGG - Intronic
949486949 3:4548977-4548999 GAGTCACTTTTCGGGAGGGGGGG + Intronic
950938796 3:16872671-16872693 GATTCATGTCTCCGGTGGGATGG - Intronic
957654055 3:83048787-83048809 GATTCACGTCCTGGGTGGGATGG + Intergenic
958469925 3:94504028-94504050 GACTCACGTTTCAGCATGGATGG + Intergenic
961331425 3:126143371-126143393 GATCCACGTATCAGGTGGGATGG + Intronic
964395452 3:156240981-156241003 CCCTCACCTTTCAGGTGGGATGG - Intronic
967500622 3:190193380-190193402 GACTCACGCCCTGGGTGGGATGG - Intergenic
976605329 4:86977296-86977318 GATTCACGTCCCAGGTGGGACGG + Intronic
993114356 5:83702087-83702109 GAGCCATGTTTCAGGTGGGAGGG + Intronic
995914134 5:117222584-117222606 GATTCATGTCCCGGGTGGGATGG - Intergenic
996621244 5:125506274-125506296 GATTCACGTTCTGGGCGGGATGG - Intergenic
998621619 5:143800835-143800857 GACCCAGGTTGCTGGTGGGAAGG - Intergenic
1000083773 5:157871066-157871088 GATTCACATTCCAGGTGGGATGG + Intergenic
1001815178 5:174662631-174662653 GATTCACGTCCCAGGTGGGATGG - Intergenic
1004888194 6:20071943-20071965 GATTCACGTTTCACATGGGATGG - Intergenic
1010408671 6:75535646-75535668 GATTCATGTTCTGGGTGGGATGG + Intergenic
1013708059 6:112862978-112863000 GAGTCACGTGCCTGGTGGGAAGG + Intergenic
1014651852 6:124049688-124049710 GATTCATGTTCCAGGTGGGATGG - Intronic
1015950368 6:138546970-138546992 GACTCACGTCTCTGTGGGGAAGG - Intronic
1022402723 7:30055897-30055919 GGCTCACATTTTGGGAGGGAAGG - Intronic
1023244810 7:38190197-38190219 GATTCATGTTCTGGGTGGGATGG + Intronic
1023357196 7:39379110-39379132 GACTCAGGAATCGGGTAGGAGGG + Intronic
1027343127 7:77231084-77231106 GATTCACATTTCAGGTGGGATGG - Intronic
1033654639 7:143364423-143364445 GACAGAAGTTTCAGGTGGGAAGG - Intergenic
1036642309 8:10592119-10592141 GATTCCCGTTCCGGCTGGGAGGG - Intergenic
1037020881 8:13968763-13968785 GACTTAAGTTTGGGGTGGGGTGG + Intergenic
1038891345 8:31727982-31728004 GATTCACGTCCCGGGTAGGAGGG + Intronic
1039560000 8:38505086-38505108 GACTGATGTTTGGGGTGGGCAGG + Intergenic
1043598630 8:81914265-81914287 GCCTGACATTTCTGGTGGGATGG - Intergenic
1044923548 8:97189667-97189689 GACTCATGTCCTGGGTGGGATGG + Intergenic
1046059742 8:109123927-109123949 GATTCACGTTTTGGGTCGGATGG + Intergenic
1047109748 8:121776348-121776370 GATTCACGTTCAGGGTGGGATGG - Intergenic
1053791382 9:41688626-41688648 GACTCACGGGTGGGATGGGACGG - Intergenic
1054153774 9:61626144-61626166 GACTCACGGGTGGGATGGGACGG + Intergenic
1054179731 9:61900320-61900342 GACTCACGGGTGGGATGGGACGG - Intergenic
1054473560 9:65557264-65557286 GACTCACGGGTGGGATGGGATGG + Intergenic
1055623629 9:78150503-78150525 GAGTGCCGTTTGGGGTGGGAAGG - Intergenic
1057475111 9:95393129-95393151 GATTCACGTCCTGGGTGGGATGG - Intergenic
1062392936 9:136341175-136341197 CACTCAGGATGCGGGTGGGAAGG - Intronic
1188761646 X:34039878-34039900 GACCCACGTTCCGTGTGGGTGGG + Intergenic
1191100835 X:56726403-56726425 GACTCAGGGAACGGGTGGGAGGG + Intergenic
1194229277 X:91301779-91301801 GACTCACGTTTCAGGTCAGTAGG - Intergenic
1194791250 X:98153328-98153350 GACTCCCATGTTGGGTGGGAAGG - Intergenic
1196036624 X:111151923-111151945 GATTCACATTTCAGGTGGAATGG + Intronic
1198241715 X:134794334-134794356 GACACATGTTTAGGGTGAGAGGG - Intronic
1200041581 X:153374659-153374681 GACTCACGCTTCGGGTAGGATGG - Intergenic