ID: 925375123

View in Genome Browser
Species Human (GRCh38)
Location 2:3378674-3378696
Sequence CTGGAAGCCCCGGTGGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925375123 Original CRISPR CTGGAAGCCCCGGTGGAACC AGG (reversed) Intergenic
900378667 1:2373062-2373084 CTGCAGGCCCCGGTGGAGCAGGG - Intronic
900617260 1:3571028-3571050 CTGGAGGCCCCCGAGGAACATGG - Intronic
902178604 1:14670333-14670355 CTGGAAGCCTCGTTGAAAACAGG + Intronic
902235756 1:15056297-15056319 CTCGAAGCCGTGGTGGAGCCAGG - Intronic
902806413 1:18863841-18863863 CTGGAAGACACCGGGGAACCAGG + Intronic
903330186 1:22593237-22593259 CAGGATCCCCAGGTGGAACCTGG + Intronic
904393261 1:30199505-30199527 CTGGAAGCCTGGGAGGAACCAGG + Intergenic
907305028 1:53508566-53508588 CCCGCAGCCCAGGTGGAACCAGG - Intronic
907859272 1:58335587-58335609 CTGGAGGCCAGGGTGGAAACGGG + Intronic
912710269 1:111944839-111944861 CCGGAGGCCCAGGTTGAACCAGG + Intronic
912953989 1:114139853-114139875 CTGGATGCCCTGGAGGAACAAGG - Exonic
915558104 1:156671007-156671029 CTGGCAGCCCCTGGGGAGCCTGG + Exonic
916202403 1:162284428-162284450 CTGGCAGCCGTGATGGAACCTGG + Intronic
919409806 1:197228667-197228689 CTGGAAGCCACTTTGGAACTGGG - Intergenic
921101153 1:211930597-211930619 CTGGAAGACCCTGTGGAAGGTGG - Intergenic
922726553 1:227925553-227925575 CAGGAAGCCCTGCTGGAGCCTGG + Intronic
923547286 1:234932031-234932053 CTGGGAGCCCCGGTGTAGACTGG - Intergenic
923790614 1:237108048-237108070 CTGGAAACCTCTGTGGAAGCTGG + Intronic
1063133025 10:3194903-3194925 CTGGAGGCCCTGGTGGCTCCTGG + Intergenic
1065122741 10:22544500-22544522 CTGGAAGCCTCTCTGGAGCCAGG + Intronic
1067248043 10:44562586-44562608 GTGGAAGCCCAAGTGAAACCAGG + Intergenic
1069818214 10:71212118-71212140 CTGTAAGCCCCCGCGTAACCAGG + Intergenic
1070693339 10:78543680-78543702 CTATAAGCCCAGGGGGAACCCGG + Intergenic
1073509711 10:104035314-104035336 CTGGGATCCCTGGTGGACCCGGG + Exonic
1076250850 10:128982774-128982796 CTGGATGCCCAGGTTGAGCCAGG + Intergenic
1076434451 10:130430584-130430606 CTGGTGGCCTCAGTGGAACCAGG + Intergenic
1076675246 10:132144202-132144224 CTAGAAGCCTCGGTGGCACTCGG + Intronic
1076804386 10:132847766-132847788 CTGGCAGCCCCTGAAGAACCTGG + Intronic
1078095479 11:8293814-8293836 CTGCAAGGCCCTGTGTAACCTGG + Intergenic
1079851742 11:25543762-25543784 CAGGAAGCATCCGTGGAACCAGG + Intergenic
1080897795 11:36460786-36460808 ATGGAAGCACCTGTGGTACCAGG - Intronic
1082013618 11:47467752-47467774 CCGGAAGCCCCGGTAAGACCTGG + Intronic
1084031079 11:66480766-66480788 CTGACAGCCCCGTTGGAACCCGG - Intronic
1088735220 11:112723143-112723165 CTGGAGGTTCCTGTGGAACCTGG + Intergenic
1090411425 11:126512400-126512422 CTGGAAGCCCCGCTGGCCACTGG - Intronic
1091388802 12:112536-112558 CTGGAAGCCCAGGTGCTGCCTGG - Intronic
1101398533 12:104368814-104368836 CTGGAAGCCCAGGTGGGGCTTGG - Intergenic
1101408690 12:104452068-104452090 CTGGAATCCCTGGTGGCACTGGG + Intergenic
1103918632 12:124388472-124388494 CTGGAAGCAGGGGTGGGACCTGG - Intronic
1105944272 13:25176323-25176345 CTGGAAGCCTGGGGGGAACATGG - Intergenic
1107061331 13:36162773-36162795 CTGGAAGACCCGGGGGATCTTGG - Intergenic
1108031167 13:46231194-46231216 GTGGAAGCCACTTTGGAACCAGG - Intronic
1116126677 14:40797249-40797271 CTGGAAGCACCTTTGGAACTGGG - Intergenic
1121098503 14:91234004-91234026 CTGGAAGGCCGGGTGGAGCTTGG + Exonic
1121341968 14:93110841-93110863 CTGGAAGCCCCAGCCTAACCTGG + Intronic
1123517773 15:21045524-21045546 CTGGAAGCAACTTTGGAACCGGG + Intergenic
1123924984 15:25099773-25099795 CTGGTAGACCCTGGGGAACCAGG + Intergenic
1126111813 15:45179666-45179688 CTGGCAGCCCTGGGTGAACCGGG - Intronic
1131085935 15:89575708-89575730 CTTGAAGGCCCAGTGGACCCTGG - Exonic
1133236023 16:4387809-4387831 CTGGAAGCTCCGGGGGTACAGGG + Intronic
1136027119 16:27475652-27475674 ATCGAACCCCCGGTGGAGCCTGG - Intronic
1138166152 16:54803452-54803474 CAGGAAGTCCCGGAGGATCCAGG + Intergenic
1138383142 16:56617495-56617517 CTGGAAGGCACGTTGGAGCCTGG - Intergenic
1139062058 16:63264127-63264149 CTGGAGGCCCTGGTGGAAGGGGG + Intergenic
1139776687 16:69320837-69320859 CTGGCAGCCCGGGTGCAGCCTGG + Intronic
1140462159 16:75148640-75148662 CTGGAAGCCCCTCTCGTACCTGG - Exonic
1141989923 16:87603664-87603686 CTGGAAGCCACGGCGGCTCCTGG + Intronic
1142113768 16:88345829-88345851 CTGGCAGCCTCGGTGGGGCCTGG - Intergenic
1142210345 16:88805601-88805623 CTGGACGCCCCGCTGGACCTTGG - Exonic
1143036283 17:4001115-4001137 CTGAAAACCCAGGTGGAAGCAGG + Intergenic
1145827468 17:27887862-27887884 CTGGAAGCTGCTGTAGAACCAGG + Intronic
1150250448 17:63701539-63701561 CGGGAAGCCCCGGGGGTACTAGG + Intergenic
1151465877 17:74284947-74284969 CTGGGAGCCCCCGTGGGACCTGG + Intronic
1152147361 17:78576525-78576547 CTGAAAGCCCTGTGGGAACCTGG - Intronic
1152437501 17:80285364-80285386 ATGGCAGCCCCGGAGGTACCAGG + Intronic
1152641953 17:81452923-81452945 CTGGAAGCCTCAGGGGAGCCTGG - Intronic
1159601164 18:70430259-70430281 CCGGAAGCCCCGGGGGACCCTGG + Intergenic
1160349638 18:78165606-78165628 GTGGAAGCCCCGGTGGCAGGAGG - Intergenic
1160451593 18:78970130-78970152 CTGGAAGCCAGGGCGCAACCGGG - Intergenic
1160537915 18:79604771-79604793 CTGGGACCCCCAGGGGAACCTGG + Intergenic
1160894876 19:1397643-1397665 CTGGAAGCCCAGGTGTGAACGGG + Intronic
1161637027 19:5395356-5395378 CTGGGGGCTCCGGTGGAGCCCGG + Intergenic
1162464142 19:10830575-10830597 CTGGGAGCCCCGGAGTCACCAGG - Intronic
1163534642 19:17870176-17870198 CTGGAAACCCCGTTGGAAAAGGG - Intergenic
1163669887 19:18621147-18621169 CTGGAAACCCAGGTGGCACCAGG + Intergenic
1164159998 19:22620188-22620210 CTGGAAGCCCTGGTCACACCGGG - Intergenic
1165461350 19:35945901-35945923 CTGGGAGCCCCAGGGGAAGCTGG + Intergenic
1166312091 19:41968804-41968826 CTGCAAGACCCGGAGGAACTCGG - Exonic
1167609988 19:50502306-50502328 CTGGATCCCCCGGTGGGCCCCGG - Intergenic
925375123 2:3378674-3378696 CTGGAAGCCCCGGTGGAACCAGG - Intergenic
926013712 2:9429222-9429244 CCGGCAGCCCCAGTGGGACCTGG - Intronic
926621557 2:15050749-15050771 GTGGAAACCCAGATGGAACCCGG - Intergenic
927243035 2:20935298-20935320 GTGGAAGCCTCGGGGGAGCCAGG + Intergenic
927853514 2:26514189-26514211 CTGGCAGCCCCAGTGGCAGCAGG + Intronic
930411301 2:51028680-51028702 CTGGTACCACTGGTGGAACCTGG - Exonic
930666582 2:54105180-54105202 GTGGAAGCCACGGTGGAGTCTGG - Intronic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
934603618 2:95678081-95678103 CTGGAAGCTCCAGTTGCACCTGG + Intergenic
936153699 2:110035271-110035293 CTGGAAGCCACAGTGGGGCCAGG + Intergenic
936190986 2:110336144-110336166 CTGGAAGCCACAGTGGGGCCAGG - Intergenic
936537000 2:113320317-113320339 CTGGAAGCTCCAGTTGCACCTGG + Intergenic
937238629 2:120446143-120446165 CTGGAGGCTGAGGTGGAACCTGG - Intergenic
937566876 2:123303946-123303968 TTGGAATCCCCAGTGGAATCAGG - Intergenic
937844519 2:126565036-126565058 CTGGGAGCCTGGGTGGATCCTGG + Intergenic
939488973 2:142854082-142854104 CTTTAAGCCCCGGGGCAACCAGG + Intergenic
942543542 2:177039141-177039163 CTGGAAGCCCTGGAGGGAACAGG - Intergenic
946421362 2:219566967-219566989 CCGGAGGGCCAGGTGGAACCTGG - Exonic
947536004 2:230940789-230940811 CTGCAGGCCCCGGTGCAGCCAGG - Intronic
948695589 2:239731691-239731713 CTGGAAGGCCCACTGGAGCCAGG - Intergenic
1169020588 20:2328042-2328064 CTGGAAGGCCCTGGGGAATCGGG + Intronic
1170727706 20:18944348-18944370 CTGGCAGCCAGTGTGGAACCAGG + Intergenic
1172015095 20:31868853-31868875 CTGGAAGCCCCTGAAGAACAAGG + Intronic
1174355560 20:49995657-49995679 GTGGAGGCCCTTGTGGAACCAGG - Intergenic
1174497120 20:50955231-50955253 ATGGAAGCCCAGATGGAACAAGG - Exonic
1175663349 20:60836662-60836684 CTGGGAGTCACGGTGGAAGCAGG - Intergenic
1176141630 20:63547524-63547546 CTGGCAGGGCCGGTGGGACCCGG + Intergenic
1179464258 21:41561300-41561322 CAGGAAGCCCTAGTGGAGCCCGG - Intergenic
1179932298 21:44578887-44578909 CTGAAAGCCCATGCGGAACCTGG + Intronic
1180006300 21:45022538-45022560 CTGGAGGCCCGGGTGGAAGACGG + Intergenic
1180072486 21:45443290-45443312 CTGGCAGCCCCATGGGAACCTGG + Intronic
1180612923 22:17109248-17109270 CTGGTGGCCGCGGTGGAGCCTGG + Exonic
1180614850 22:17120525-17120547 CTGGTAGCCCCAGCGGCACCTGG + Exonic
1181856571 22:25785405-25785427 CTGGAAGCACAGAAGGAACCAGG - Intronic
1182167286 22:28188751-28188773 CTGGAAGCCCCTGTGGAAATTGG + Intronic
1182508174 22:30800368-30800390 AAGGAAGCACTGGTGGAACCTGG + Intronic
1183952052 22:41357625-41357647 CCGGAGGCCCCGCTGAAACCTGG + Exonic
1184145677 22:42608875-42608897 TTGAAAGCACTGGTGGAACCAGG - Intronic
950152583 3:10699040-10699062 CTGGAAGGCCGGAGGGAACCAGG - Intronic
952840230 3:37640050-37640072 CTGGAAGCCCTGCTGTAGCCAGG - Intronic
952912112 3:38199884-38199906 ATGGAAGCCCCACTGGCACCAGG - Intronic
957056172 3:75444675-75444697 CTGCCAGCCCCGCTGGACCCAGG - Intergenic
960373893 3:116874793-116874815 CTGGAACTCCTGGTGGAAGCTGG - Intronic
961380096 3:126491478-126491500 CTGGAAGCCCAGGTGTTCCCGGG - Intronic
962005423 3:131344491-131344513 GTGGAAGCACCTTTGGAACCTGG - Intronic
962744910 3:138389931-138389953 CTGGAAGCCTGGGTGGAAGAGGG + Intronic
963606818 3:147419574-147419596 CTGGTAGGCCCGGTGTAAACTGG - Intronic
963683657 3:148411269-148411291 TTGGAAGCCACTGTGGAACCAGG - Intergenic
967887189 3:194341338-194341360 CTGGAAGCCCAAGTGGTCCCGGG + Exonic
968611224 4:1558055-1558077 CTGGGAGCACCGTTGGGACCTGG - Intergenic
969523808 4:7693950-7693972 ATGGGAGCACCGGCGGAACCTGG + Intronic
969652766 4:8477687-8477709 CTGAAAGCCCTGGTGCAGCCTGG - Intronic
969696651 4:8738754-8738776 CTGGGAACGCCGGTGGATCCCGG - Intergenic
976715547 4:88119393-88119415 CTGGAAGCCACTTTGGAACTGGG + Intronic
978322585 4:107514824-107514846 GTGGAAGCCACTTTGGAACCTGG + Intergenic
983908082 4:173205743-173205765 CTGAAACCCGGGGTGGAACCTGG + Intronic
985778260 5:1856757-1856779 CTGGGAGCCAAGGTGGAGCCGGG - Intergenic
986516616 5:8571336-8571358 CTGACATCCCCGATGGAACCTGG + Intergenic
987193276 5:15500469-15500491 CTGGCACCCCCGGTGGCTCCAGG - Exonic
993703785 5:91147774-91147796 GTGGAAGCGCCGTTGGAACTAGG + Intronic
996403470 5:123086613-123086635 CCGGAAGCCGCGGTGGAGGCAGG + Intergenic
998989928 5:147804379-147804401 CTGGAAGCTGCGATTGAACCTGG + Intergenic
999434273 5:151550901-151550923 CTGCAAGCCCCAGGGGAACAGGG + Intronic
1000328234 5:160188175-160188197 CGGGAAGCCCTGGTGGAATGGGG + Intronic
1001440426 5:171738546-171738568 CTGGAAGCCCCAGAGGAGCTTGG - Intergenic
1001445059 5:171776477-171776499 CTGGAAGTCCTGGTTGAACGCGG - Intergenic
1006024593 6:31138993-31139015 CTGGAAGCTCCTGGGGATCCTGG - Exonic
1016603288 6:145888577-145888599 CTGGAAGGCCCTGTGTGACCTGG - Intronic
1018298208 6:162372043-162372065 CTGGAAGCCCAGGAGAAAGCTGG + Intronic
1022527953 7:31050412-31050434 CTGGAACCCGCAGTGGAAACTGG + Intergenic
1022909246 7:34883992-34884014 GTGGAAGCCACTTTGGAACCAGG - Intergenic
1022972136 7:35528151-35528173 CTGGAGGCCCAGCTGGAACTGGG - Intergenic
1025941857 7:66080994-66081016 CCAGAAGCCCTGGTGGAACAGGG + Intronic
1026952405 7:74356397-74356419 CTGGAAGTACCTGTGGAAGCAGG - Exonic
1027858135 7:83539199-83539221 CTGGGAGCCCAGGGGGAAGCTGG + Intronic
1029663355 7:101978439-101978461 CTGGGAGCCCAGGTGTATCCAGG - Intronic
1031483171 7:122302000-122302022 CTGGTGGCCCTGGTGGAGCCCGG + Exonic
1034269708 7:149797646-149797668 CGGGAAGCCCCTGGGGACCCGGG - Intergenic
1036378255 8:8218993-8219015 CTGCCAGCCCCGCTGGACCCAGG + Intergenic
1039954254 8:42195145-42195167 CTGGAAGCCCCTGTGCCTCCAGG - Intronic
1041165363 8:55086942-55086964 CTGGAAGCCCTGGTGTTTCCTGG - Intergenic
1042954470 8:74234238-74234260 CTGGAAGTCCCGGTGGTGGCAGG + Intergenic
1043156223 8:76783794-76783816 CTGGAAGCCCCATTTGAACCGGG - Intronic
1045030848 8:98134581-98134603 CTGGAAGTCCCAGAGGACCCCGG + Exonic
1048252163 8:132875820-132875842 CTGGAAGCCCAGCTGTAATCAGG + Intronic
1049641467 8:143717859-143717881 CTGGAAGCTCAGGTGGGAGCTGG + Intronic
1049670886 8:143869394-143869416 CTGGAAGCCCAGGTGGCATCTGG - Exonic
1051858345 9:21595765-21595787 AAGGAAGCCTCAGTGGAACCTGG + Intergenic
1055798877 9:80009262-80009284 CTGGAAGCTGCTGTAGAACCAGG + Intergenic
1057128528 9:92637862-92637884 CTGGGAGCCCTGGCGTAACCAGG + Intronic
1060416658 9:123435432-123435454 CTGGAAGCCACGGTGGTGCTTGG + Intronic
1062020908 9:134319053-134319075 CTGGCAGGGCAGGTGGAACCTGG + Intronic
1062156531 9:135051944-135051966 CTTGAAGCCACGTTGGTACCAGG - Intergenic
1062220149 9:135410670-135410692 CTGGAAAACCCTGTGGATCCAGG + Intergenic
1186638278 X:11428345-11428367 CTGCAAGCCCCCCTGGAACTCGG - Intronic
1193674818 X:84437567-84437589 CTGGAAGCTCTAGTGGAACTAGG - Intronic
1202264791 Y:23006772-23006794 CTGGAATCCCCAGTGGAAGGAGG - Intergenic
1202417782 Y:24640514-24640536 CTGGAATCCCCAGTGGAAGGAGG - Intergenic
1202453004 Y:25029572-25029594 CTGGAATCCCCAGTGGAAGGAGG + Intergenic