ID: 925376244

View in Genome Browser
Species Human (GRCh38)
Location 2:3388172-3388194
Sequence CAGCTTCGGTGGCGCCAGCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925376232_925376244 24 Left 925376232 2:3388125-3388147 CCCCCAGCCTCCGGGGACGGCTT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 78
925376235_925376244 21 Left 925376235 2:3388128-3388150 CCAGCCTCCGGGGACGGCTTCGA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 78
925376233_925376244 23 Left 925376233 2:3388126-3388148 CCCCAGCCTCCGGGGACGGCTTC 0: 1
1: 0
2: 0
3: 24
4: 190
Right 925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 78
925376239_925376244 -3 Left 925376239 2:3388152-3388174 CCGCAGATGGTGAAGTCGCCCAG 0: 1
1: 0
2: 0
3: 4
4: 96
Right 925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 78
925376237_925376244 14 Left 925376237 2:3388135-3388157 CCGGGGACGGCTTCGAGCCGCAG 0: 1
1: 0
2: 0
3: 2
4: 50
Right 925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 78
925376234_925376244 22 Left 925376234 2:3388127-3388149 CCCAGCCTCCGGGGACGGCTTCG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 78
925376236_925376244 17 Left 925376236 2:3388132-3388154 CCTCCGGGGACGGCTTCGAGCCG 0: 1
1: 0
2: 0
3: 4
4: 35
Right 925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG 0: 1
1: 0
2: 1
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925376244 Original CRISPR CAGCTTCGGTGGCGCCAGCG AGG Exonic
904652235 1:32014174-32014196 CAGCAGCGGTGGCGGCTGCGTGG - Exonic
905051200 1:35052609-35052631 AAGATTCTGTGGCGCTAGCGAGG + Intergenic
1069901468 10:71708918-71708940 CAGCTTGGGTGGGCTCAGCGGGG - Intronic
1076246315 10:128950179-128950201 CACCTTCTGTGGCTCCAGTGGGG - Intergenic
1076900692 10:133336110-133336132 AGGCTGCGGTGGCGCCCGCGGGG - Intronic
1077507811 11:2940260-2940282 CAGCCTGGGGGCCGCCAGCGAGG - Intergenic
1083428465 11:62601621-62601643 TAGCTGCGGCGGCGACAGCGCGG - Exonic
1083674539 11:64318163-64318185 CTGCTGCGGTGGCACCAGCCAGG + Exonic
1083728791 11:64642442-64642464 CAGCTGGGGTGGGGCCCGCGGGG + Intronic
1084284199 11:68121096-68121118 GAGCTGCGGTAGCGGCAGCGCGG - Exonic
1088004827 11:104927361-104927383 CAGCCTCCCTGGCTCCAGCGGGG - Intergenic
1090918347 11:131186698-131186720 CAGCTTCACTGCAGCCAGCGTGG - Intergenic
1094218547 12:27970469-27970491 CAGCTCCGGGGTCGGCAGCGCGG - Intronic
1096717771 12:53501374-53501396 CAGTCACGGTGGCGCCCGCGGGG + Exonic
1097190349 12:57216666-57216688 CACCTTCGGTGCCCCCAGCTGGG + Intergenic
1097269466 12:57765365-57765387 CGGCGTCTGAGGCGCCAGCGGGG - Exonic
1101870597 12:108562517-108562539 AAGCTTCGGTGACGTCAGAGAGG + Intergenic
1105015480 12:132784129-132784151 CATCTGCTGTGGCGGCAGCGTGG - Intronic
1105038176 12:132941617-132941639 CAGCTTCGGTGGCTGCTGGGAGG + Intronic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1125677578 15:41511200-41511222 CGGCTTCGGGGGCGGCGGCGGGG - Exonic
1126087413 15:45023106-45023128 CAGCCTGGGCGGCGCTAGCGTGG - Exonic
1131108635 15:89750768-89750790 CAGCGCCGGTGCCGGCAGCGCGG - Exonic
1143088336 17:4433673-4433695 CAGCTTCAGTGGCTGCAGTGAGG - Exonic
1143540100 17:7563521-7563543 AAGCTTTGGGGGCGCCACCGGGG + Exonic
1146454213 17:32996744-32996766 GAGGCTCGGTGGAGCCAGCGTGG + Intronic
1148490844 17:48023441-48023463 CGGCTGCGGTCCCGCCAGCGGGG + Intergenic
1151156132 17:72123921-72123943 CGGCTGCGGGGGCGCCTGCGGGG - Exonic
1152095217 17:78268509-78268531 CAGCTTCGGAGGCTTCAGCAAGG + Intergenic
1152303494 17:79508537-79508559 CAGCTTCGGCCGAGCCAGCGCGG - Intronic
1152748200 17:82050926-82050948 CAGCCTCGGTGGCACCAGCAGGG - Intronic
1153787727 18:8549514-8549536 TACCTTCACTGGCGCCAGCGTGG + Intergenic
1157222721 18:45838980-45839002 CCGCTTCCATGGCGCCAGCGGGG + Exonic
1157789388 18:50517764-50517786 CAGGTTGGGTGGAGCCAGTGTGG + Intergenic
1158976715 18:62716489-62716511 CGGCTCCGGGGGCGCCAGCCGGG - Exonic
1159040576 18:63320037-63320059 CAGCGGCGGCGGCGGCAGCGCGG + Exonic
1161901487 19:7122851-7122873 CTGCTTCGGGGGACCCAGCGGGG - Intronic
1163361149 19:16847136-16847158 CAGCCTCGGGGGCCTCAGCGAGG + Intronic
1167082193 19:47284203-47284225 CAGCCTGGGTGGTGACAGCGAGG + Intergenic
1167385788 19:49162583-49162605 CAGTTTCTGTGGCTCCACCGAGG + Intronic
925376244 2:3388172-3388194 CAGCTTCGGTGGCGCCAGCGAGG + Exonic
939398347 2:141660481-141660503 CAGTTTCCGCGGCACCAGCGGGG - Intronic
944385105 2:199155115-199155137 CAGCTTCCTTGGCTCCAGCAGGG - Intergenic
944579045 2:201116504-201116526 CAGCTCCGGCGCCGCCAGCGCGG - Intronic
947709892 2:232307042-232307064 CAGCTTTGGTGGTGCCTGTGAGG - Intronic
947723248 2:232381687-232381709 CGGCGTCGGTGGTGCCGGCGGGG - Exonic
947727594 2:232409764-232409786 CGGCGTCGGTGGTGCCGGCGCGG - Exonic
947968429 2:234301809-234301831 CAGCTCCGGTGGCACCAGTTTGG + Intergenic
948606604 2:239139725-239139747 CAGCTCCGGGAGCGTCAGCGCGG - Exonic
1172853148 20:37981165-37981187 CAGTCTCGGTGGCGGCAGCCTGG - Intergenic
1177332889 21:19684237-19684259 CAGCTTCCCTGGCTCCAGCAGGG + Intergenic
1180252568 21:46598748-46598770 CAGCTCTGGGGGCTCCAGCGTGG - Intergenic
1181175211 22:21031413-21031435 CATCATCGGTGGCGCCGCCGTGG - Exonic
1181784829 22:25219437-25219459 CAGATTCGGCCGCGCCAGGGCGG - Intergenic
952503799 3:33989296-33989318 CAGCTTCCCTGGCTCCAGCAGGG + Intergenic
953150691 3:40321878-40321900 CAGCTTCTGTGGTGTCAGGGAGG + Intergenic
954583409 3:51715750-51715772 CATCTTCGGTGGGGCCCGGGAGG + Exonic
956673195 3:71710459-71710481 CAGCTGCTGTGGCACCAGGGAGG + Exonic
960477268 3:118144976-118144998 CAGCTTCCCTGGCTCCAGCAGGG + Intergenic
967204118 3:187103764-187103786 CAGCTTCAGTGGCAGCATCGTGG + Intergenic
968514418 4:1010280-1010302 CAGCGGCGGCTGCGCCAGCGGGG + Intronic
968845966 4:3041705-3041727 CAGCTTCAAGGCCGCCAGCGAGG - Intergenic
968911387 4:3478494-3478516 CAGGTTCTGTGGGGCCAGCCTGG - Intronic
975489831 4:74976260-74976282 CAGCTTCCCTGGCACCAGCAGGG - Intronic
978392007 4:108236777-108236799 CAGCTTCTGTGGGTCCAGCTTGG + Intergenic
979197848 4:117941637-117941659 CAGCTTCCCTGGCTCCAGCAGGG + Intergenic
992820116 5:80487990-80488012 CCGCTTCGCTGGCGCCCGCCGGG + Exonic
995666170 5:114544817-114544839 CAGCTTCCCTGGCTCCAGCAGGG - Intergenic
995960162 5:117829755-117829777 CAGCTTCCCTGGCTCCAGCAGGG + Intergenic
997228696 5:132227961-132227983 CAGCTCCGGTGGCTCCGCCGGGG + Intronic
1010203005 6:73299384-73299406 CAGCTTTGTTGGAGACAGCGCGG + Intronic
1011610502 6:89146197-89146219 CAGCTTCAGTAGCTCCAGCTCGG - Exonic
1018920400 6:168168353-168168375 CTGCTGCGGTGGCTGCAGCGTGG + Intergenic
1021101101 7:16586564-16586586 CTGCTGCGGTGGCGGCTGCGTGG + Intergenic
1030754695 7:113273219-113273241 CAGCCTCTGTGGCTCCAGCCGGG - Intergenic
1034267218 7:149787051-149787073 CAGCCTCGGTGGCGGCAGGCTGG - Intergenic
1034446770 7:151117728-151117750 CAGCTTCCGCAACGCCAGCGAGG + Exonic
1035534901 8:383599-383621 CAGCTACGGAGGCCCCAGTGAGG + Intergenic
1056975160 9:91246048-91246070 CAGATTCGGTGGAGGCAGCCTGG + Intronic
1059596282 9:115724137-115724159 CAGCATCACTGGCTCCAGCGGGG - Intergenic
1186739076 X:12498105-12498127 CAGCTTCGGTGGTGCCAGCCTGG + Intronic
1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG + Intergenic
1192343524 X:70282570-70282592 CAGCTTCGGCTGCGCCTGCCAGG + Exonic
1194596706 X:95867918-95867940 CAGCTTCCCTGGCTCCAGCAGGG - Intergenic