ID: 925378272

View in Genome Browser
Species Human (GRCh38)
Location 2:3404544-3404566
Sequence CATTATATGCATGAACTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925378266_925378272 25 Left 925378266 2:3404496-3404518 CCGAACATTGGCAAAGCAGCCTT 0: 1
1: 0
2: 1
3: 16
4: 160
Right 925378272 2:3404544-3404566 CATTATATGCATGAACTGGGAGG 0: 1
1: 0
2: 2
3: 5
4: 137
925378268_925378272 6 Left 925378268 2:3404515-3404537 CCTTAGTTACTTGGATTTTATCC 0: 1
1: 0
2: 2
3: 14
4: 197
Right 925378272 2:3404544-3404566 CATTATATGCATGAACTGGGAGG 0: 1
1: 0
2: 2
3: 5
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925378272 Original CRISPR CATTATATGCATGAACTGGG AGG Intronic
902773245 1:18658375-18658397 TATTATAAGCATGCACTGGAAGG - Intronic
903361109 1:22777819-22777841 CAGTATGTGCAGGCACTGGGTGG + Intronic
911792292 1:102032701-102032723 CAGTATTTGCATGAAGTGAGCGG + Intergenic
916219109 1:162425578-162425600 AACAATATGAATGAACTGGGAGG + Intergenic
918094402 1:181322626-181322648 CAATACATGCATGGACTTGGGGG + Intergenic
918765140 1:188472369-188472391 AATGATGTGCATGAGCTGGGTGG + Intergenic
924458909 1:244240719-244240741 CATTGTATGTATGCATTGGGAGG + Intergenic
1063290576 10:4742644-4742666 CATTATATTGATCAACTGGCAGG - Intergenic
1064621567 10:17222619-17222641 CAGTATAAGCAAAAACTGGGTGG - Intergenic
1064808991 10:19172596-19172618 CATTATTTGAATGGAATGGGTGG - Intronic
1066723252 10:38362347-38362369 CATTTTATGGATGAACTGATTGG + Intergenic
1067695171 10:48529320-48529342 CATAAGATGCAAGAACTGGAAGG - Intronic
1069340210 10:67401260-67401282 CAGTATATGCTGAAACTGGGTGG - Intronic
1070468513 10:76750812-76750834 CATAATATTCAAGAACTGTGGGG + Intergenic
1071015154 10:80988141-80988163 AATTATATTCATGATGTGGGAGG - Intergenic
1073031088 10:100526428-100526450 CATGATATTCATGTGCTGGGTGG - Exonic
1073967721 10:109010888-109010910 ATTTATATGCATGAATTGTGAGG - Intergenic
1074273654 10:111980170-111980192 GATAATATGGATGAACTTGGAGG - Intergenic
1080409369 11:32009363-32009385 CATTATATGCATGATGTGGGAGG + Intronic
1081846082 11:46241420-46241442 CATTATATGTAGGTGCTGGGAGG + Intergenic
1083583123 11:63838031-63838053 CATTGGATTCATGAACTCGGAGG - Intergenic
1085546482 11:77323030-77323052 CCTCATATCCATGAATTGGGAGG + Exonic
1086853078 11:91834269-91834291 CATTCTATGCCTGAACTAGTAGG - Intergenic
1089644306 11:119868325-119868347 CATCATATCCATGTCCTGGGTGG + Intergenic
1089847480 11:121469842-121469864 CAGAATATGCATGAGGTGGGAGG + Intronic
1090339553 11:126004842-126004864 CAGTACATGAATGAAATGGGAGG - Intronic
1091040521 11:132276137-132276159 CATTACATGAATGAACCTGGAGG - Intronic
1091423306 12:362769-362791 TTTTAAATGCATGAACTGTGTGG - Intronic
1094084603 12:26575779-26575801 AATTCTATGCATGAACTGATTGG + Intronic
1095449325 12:42313305-42313327 TATTGTCTGCATGGACTGGGAGG - Intronic
1096568827 12:52506531-52506553 CAGAATATGCAAGAACTGTGGGG - Intergenic
1096607745 12:52778588-52778610 CATTATAAGAATGACCTGGAGGG - Intergenic
1097686318 12:62694195-62694217 CTTTATATGCTTGAAGAGGGAGG + Intronic
1099564427 12:84223841-84223863 CAATATATGCATGAATTGGTGGG + Intergenic
1099705635 12:86150023-86150045 CAATGTTTTCATGAACTGGGTGG + Intronic
1102189946 12:110980200-110980222 CATTAGGTGTATGAATTGGGTGG + Intergenic
1103470856 12:121179776-121179798 AATTTTATGCAGCAACTGGGGGG + Intronic
1105761299 13:23517167-23517189 CATTAAATGAAAGAACTGTGTGG - Intergenic
1106339779 13:28817735-28817757 CTTTCTTTGCATGAAGTGGGTGG - Intergenic
1106818466 13:33436603-33436625 CATAATAGGCATAAACTGGGAGG + Intergenic
1108793162 13:53997363-53997385 CATTCTCTGCATGAACAGTGTGG + Intergenic
1109900773 13:68766497-68766519 GTTTATATGGATGTACTGGGTGG + Intergenic
1110687785 13:78395558-78395580 CAATATATGGATGAGGTGGGAGG + Intergenic
1110797372 13:79655835-79655857 CATTACATGCATGACTTTGGTGG - Intergenic
1111098042 13:83540055-83540077 TATTATCTGCATGAAATGAGAGG + Intergenic
1112644060 13:101309394-101309416 CATTATGGTCATGAACTGTGAGG - Intronic
1113029635 13:105978797-105978819 CATTACATGCATGAACTCATAGG + Intergenic
1113111206 13:106825873-106825895 CATTATTTGCTTGAACTGCAAGG + Intergenic
1114830609 14:26137205-26137227 AATTATTTCCATGAACAGGGAGG - Intergenic
1116315218 14:43378633-43378655 AATTATGTGGATGAACTGTGTGG + Intergenic
1117128263 14:52656280-52656302 CATCACATGAATGAACTTGGAGG - Intronic
1125982654 15:44017040-44017062 GATTAAAAGCATGAACTGGCCGG + Intronic
1126274085 15:46855808-46855830 CACTATATGGATGAAGTTGGAGG + Intergenic
1127232257 15:57009423-57009445 TTTTATATGGATGAACTAGGTGG + Intronic
1127309066 15:57736039-57736061 CATTCTATTCAGGGACTGGGAGG - Intronic
1135196093 16:20396156-20396178 CATTATAGGGATTAACTGAGAGG - Intronic
1135549932 16:23390131-23390153 CTTTCCAAGCATGAACTGGGAGG - Intronic
1136277851 16:29189644-29189666 CAGTTTATGCATGAATTTGGTGG + Intergenic
1137939725 16:52672260-52672282 AATTATATGCAAGTCCTGGGGGG + Intergenic
1138663881 16:58546106-58546128 AATAATATGCATGAACTGTCAGG + Intronic
1139446792 16:67003053-67003075 CATCATCTGCAAGAACAGGGAGG - Exonic
1140998083 16:80280373-80280395 CAATAAATACATGAAATGGGAGG + Intergenic
1141233288 16:82191370-82191392 CATCATATGCACGGATTGGGGGG - Intergenic
1142082226 16:88155684-88155706 CAGTTTATGCATGAATTTGGTGG + Intergenic
1144008545 17:11123521-11123543 CTTTATATCCATGAATTTGGAGG - Intergenic
1147412367 17:40262899-40262921 GATAATATGGATGAACTTGGAGG + Intronic
1148042469 17:44719309-44719331 CTTTATATGGATGAATTGTGTGG - Intronic
1149832669 17:59885411-59885433 CATGATATTCATGTTCTGGGTGG + Intronic
1150796278 17:68239963-68239985 CATTTTATCCATGAAATGAGAGG + Intergenic
1150924261 17:69516054-69516076 CAGTTTTTCCATGAACTGGGTGG + Intronic
1155863646 18:30936269-30936291 CATAATATGAATGAACATGGAGG - Intergenic
1158216979 18:55110685-55110707 CATCAAATATATGAACTGGGAGG - Intergenic
1162317509 19:9948671-9948693 CATTCTATGCATGAACTCTTAGG - Intergenic
1165716324 19:38048093-38048115 CATTAGAGGCATGAACAGGAAGG - Intronic
925035116 2:679067-679089 CAATATATGAAAGATCTGGGAGG - Intergenic
925378272 2:3404544-3404566 CATTATATGCATGAACTGGGAGG + Intronic
929527073 2:42714701-42714723 CAATTTTTTCATGAACTGGGTGG + Intronic
930095917 2:47566780-47566802 AATTATATGCATGAAATTGGTGG + Intronic
938565524 2:132515080-132515102 CAATAAATGAATGATCTGGGTGG - Intronic
938930578 2:136083141-136083163 CATTACATGCATTAACTTGATGG - Intergenic
943354681 2:186837195-186837217 CAGTATATGCAGGAAGAGGGAGG + Intronic
944750897 2:202708361-202708383 GATAATATGGATGAACTGTGAGG - Intronic
948318109 2:237045779-237045801 CATTTCAAGCATGACCTGGGAGG + Intergenic
948677366 2:239605694-239605716 CAATATATGCATGAACTGGCTGG - Intergenic
1175141069 20:56860410-56860432 CTTTATATGCATGTATTTGGGGG - Intergenic
1175694949 20:61095467-61095489 CAATTTTTCCATGAACTGGGTGG + Intergenic
1180593660 22:16960407-16960429 CATGGTGTGCATGAACTTGGTGG - Intergenic
1182035006 22:27191232-27191254 CATAAAATGCCTGAACTGGAAGG - Intergenic
1182467895 22:30529251-30529273 CAGGATATGCATGAGTTGGGGGG - Intronic
953110725 3:39935380-39935402 AAGTATATTCATGAACTGGGTGG + Intronic
953656276 3:44857266-44857288 AAGTATATGCATCAAGTGGGAGG + Intronic
954773464 3:52995797-52995819 GATTATAGGCGTGAGCTGGGGGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
964401332 3:156302383-156302405 CATTTTTTGCATGATATGGGTGG - Intronic
967281135 3:187824769-187824791 CAGTATATGCATGAGGAGGGTGG - Intergenic
967367951 3:188709153-188709175 CATTATATTCATGGATTGGAAGG - Intronic
967659050 3:192082966-192082988 CAGTATATGCATGAATGGAGTGG - Intergenic
970995650 4:22265055-22265077 CATCATATGGATGACCTGGCAGG - Intergenic
973114168 4:46434588-46434610 CATAACATGGATGAACTTGGAGG - Intronic
973944587 4:55943863-55943885 CATAACATTCATGGACTGGGAGG + Intergenic
978919502 4:114165575-114165597 CATTATGCTGATGAACTGGGAGG - Intergenic
980656009 4:135787240-135787262 CATAATGGTCATGAACTGGGGGG + Intergenic
981192878 4:141884081-141884103 CATGTTATGCATTAATTGGGTGG - Intergenic
984783759 4:183550115-183550137 CATTATATTTATGCTCTGGGTGG + Intergenic
989437445 5:41431532-41431554 AATTATCAGCATGAATTGGGAGG + Intronic
992884986 5:81149773-81149795 CTTTAAATGGGTGAACTGGGTGG - Intronic
995420503 5:111961659-111961681 CATTATATGCAGGAACTATAGGG - Intronic
1001694998 5:173663496-173663518 CACTATATGAATGACCTGAGTGG + Intergenic
1007256360 6:40532004-40532026 CCATATATGCAGGAACTGTGCGG - Intronic
1008369019 6:50712750-50712772 CATTATAAGAAAGAACTGGCTGG - Intergenic
1009242174 6:61196663-61196685 GATTACAGGCATGAGCTGGGAGG + Intergenic
1013151373 6:107449613-107449635 CATAATATGGATGAACCTGGAGG - Intronic
1013710275 6:112888861-112888883 CATTATATGAATGAATTCAGTGG - Intergenic
1013881030 6:114900979-114901001 CAGTATATGCATGGACGGAGTGG + Intergenic
1014506185 6:122260440-122260462 AATTATATGAATGAACTCTGAGG - Intergenic
1015534138 6:134249917-134249939 CGTTAAATGCATTAACTTGGTGG - Intronic
1018192360 6:161321261-161321283 AATTAAATGCATGGACTGGAAGG - Intergenic
1018435625 6:163755867-163755889 GATGATAGGAATGAACTGGGAGG - Intergenic
1018968091 6:168504217-168504239 CATTTTTTCCATGAACTGGTGGG + Intronic
1019642756 7:2113253-2113275 CAATAGATGCTTGAACTAGGAGG + Intronic
1020595899 7:10207122-10207144 CATGATATGAATCAACTGGGAGG + Intergenic
1022362287 7:29673131-29673153 CATTATATGAATAATCTGAGAGG + Intergenic
1022699109 7:32740614-32740636 CATTATATGAATAATCTGAGAGG - Intergenic
1024161083 7:46677046-46677068 CACAATATGGATGAACTTGGAGG + Intronic
1024325626 7:48107238-48107260 CATTATAGGCAGGACCTGGATGG + Intronic
1024821839 7:53340380-53340402 CATTATATGCTTGGACTTTGTGG - Intergenic
1026831589 7:73613506-73613528 CAATAATTGCTTGAACTGGGAGG + Intronic
1027463421 7:78484485-78484507 TTATATCTGCATGAACTGGGTGG - Intronic
1030645106 7:112052462-112052484 CATTATATGCCCGAAGTGAGGGG - Intronic
1030805072 7:113907252-113907274 CATTGTATTCATAAACTCGGAGG + Intronic
1036243751 8:7099851-7099873 CTTTATATGTATGAACAGGCAGG - Intergenic
1036685554 8:10907350-10907372 CATGATATGCATGAAGTCAGAGG - Intronic
1036898092 8:12651573-12651595 CTTTATATGTATGAACAGGCAGG + Intergenic
1045906122 8:107347141-107347163 TATTACATGCCCGAACTGGGAGG - Intronic
1051659199 9:19409690-19409712 CATTATAGGCATGTTCTTGGGGG - Intronic
1052763088 9:32612599-32612621 GATTATAAGCAGGAAGTGGGGGG - Intergenic
1052827444 9:33187286-33187308 CATTTTATGCATGCACAGTGGGG + Intergenic
1058125392 9:101187900-101187922 CATTATATGTATGAAGTTTGGGG + Intronic
1186231679 X:7462185-7462207 CATTATAAGAATTATCTGGGCGG - Intergenic
1186276380 X:7943176-7943198 CATTAAATGCATGAATGGCGAGG + Intergenic
1186560267 X:10604282-10604304 TATTATATGCCTGAACTTGCTGG + Intronic
1188678959 X:32978124-32978146 CATGGTTTTCATGAACTGGGCGG + Intronic
1196160902 X:112481452-112481474 CATAATATGGATGAGCTTGGAGG - Intergenic
1196978892 X:121189870-121189892 CATTTTAGGCATGACTTGGGTGG + Intergenic
1200354133 X:155530266-155530288 CATAATATGGATGAACCTGGAGG + Intronic