ID: 925379686

View in Genome Browser
Species Human (GRCh38)
Location 2:3416587-3416609
Sequence GAGGGCATAGTGAAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 11, 2: 9, 3: 31, 4: 401}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925379686 Original CRISPR GAGGGCATAGTGAAGGGGCA GGG (reversed) Intronic
900647556 1:3715785-3715807 CAGTGCATAGTGAAGGCCCAGGG - Intronic
901839951 1:11947941-11947963 GAGGGTATGGTGAATGGGAATGG - Intronic
902737595 1:18411450-18411472 GGGGCCCTACTGAAGGGGCAGGG + Intergenic
903097937 1:20997569-20997591 AGGGTGATAGTGAAGGGGCAAGG + Intronic
903234585 1:21941509-21941531 GAGAGTAGAGTGAAGGGGGATGG - Intergenic
906601839 1:47137367-47137389 GTGGGGAGAGTGAAGGGGGAGGG - Intergenic
907248227 1:53121432-53121454 GGGGGCTTGGTGAAGGGACAAGG + Intronic
907328747 1:53657881-53657903 GAGGGTGCAGAGAAGGGGCAAGG - Intronic
907441922 1:54484197-54484219 GAAGGGATAGTGAGGAGGCAAGG + Intergenic
908129024 1:61056289-61056311 GAGGGAATAATGATGGGGGAGGG - Intronic
908262568 1:62350139-62350161 GAGGGGAAAGGGAAGGGGAAAGG + Intergenic
908616192 1:65925524-65925546 GAGGAGGTAGTGATGGGGCAGGG - Intronic
909355999 1:74711047-74711069 GTGGGCATAGTGAATGGCCATGG + Intronic
909651970 1:77985640-77985662 AAGTGCATAGTTAAGGAGCAAGG - Intronic
910194940 1:84630604-84630626 GTGGACATAGTCAAGTGGCAAGG + Exonic
911449128 1:98043134-98043156 GAGGGCACAGTAAAGGAGGAGGG - Intergenic
912449159 1:109758899-109758921 GTGGGCATAGGCAAGGGGCTGGG - Intronic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
912755844 1:112324419-112324441 GAGGGCATGGTCAAAGGTCAAGG + Intergenic
912878895 1:113390187-113390209 GAGGGCGCAGAGGAGGGGCAGGG - Intergenic
913309332 1:117472183-117472205 GAGGACATAGAGAAGGCGGAAGG - Intronic
913508403 1:119540305-119540327 GGGGGCATAATGGATGGGCAGGG + Intergenic
914844802 1:151276794-151276816 GAAGGCAGAGTGAGCGGGCATGG - Intergenic
915163039 1:153933087-153933109 GAGGGGCTGGGGAAGGGGCATGG - Intronic
915601554 1:156925689-156925711 GGGAGCCTAGAGAAGGGGCAGGG - Intronic
915835697 1:159173087-159173109 GTGGGGAGAGTGAAGGGGGAGGG + Intronic
918207789 1:182324800-182324822 AAGGCCATAGTGATGGGGCTGGG - Intergenic
918331396 1:183464244-183464266 GAGGGAAGAGGGAAGGGGAAGGG + Intergenic
918570659 1:185987954-185987976 GAGGGCTTAGGGATGTGGCACGG + Intronic
919745397 1:201005491-201005513 CAGGGCATCCTGAAAGGGCAGGG - Intronic
919852995 1:201686284-201686306 GATGGAATACTGAGGGGGCAGGG - Intronic
920849077 1:209616446-209616468 GAGGGAATGGTTTAGGGGCATGG - Intronic
920926535 1:210346824-210346846 CATGGCAGAGTGGAGGGGCAGGG + Intronic
922725249 1:227920064-227920086 GCGGGCATGGTGAGGGGGCAGGG - Exonic
1063187021 10:3660732-3660754 GAGAGGATACTGAGGGGGCAAGG + Intergenic
1063288190 10:4712728-4712750 GAGGGCACAGTGGAGGGCAAGGG - Intergenic
1063493927 10:6489643-6489665 GTGAGCACAGTGGAGGGGCAGGG + Intronic
1063609848 10:7553181-7553203 GAGGGCAGAGTGCAGGGCAAAGG - Intergenic
1064302945 10:14138962-14138984 GAGGTCCCAGGGAAGGGGCAGGG - Intronic
1064626839 10:17270192-17270214 TAGGGCATAGTGAAGGGTTTTGG + Intergenic
1066013743 10:31217528-31217550 GAGGACATAATGATTGGGCAGGG - Intergenic
1066334664 10:34463301-34463323 GAGGGGAAAGGGAAGGGGAAAGG + Intronic
1066961221 10:42230208-42230230 AAGGGGACAGGGAAGGGGCAAGG + Intergenic
1067283352 10:44889720-44889742 GGGGGTATAGCGAAGGGCCATGG - Intergenic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1070142991 10:73752630-73752652 GAGGATATAGTGAGGGGGTAGGG + Intronic
1070652482 10:78247879-78247901 GAGGGGATGCTGAAAGGGCAGGG - Intergenic
1070689260 10:78512489-78512511 GAGCCCAAAGTGAAGGGGCATGG - Intergenic
1070753995 10:78980435-78980457 GACGGCATCAAGAAGGGGCAAGG + Intergenic
1070978886 10:80628540-80628562 GAGGGCAAAGTGAATGGGGAAGG + Intronic
1071105552 10:82089951-82089973 GAGGGCAAAGAGCTGGGGCAGGG - Intronic
1072659390 10:97354103-97354125 AGGGAAATAGTGAAGGGGCAAGG + Intergenic
1072783876 10:98267799-98267821 GAGGAGACAGGGAAGGGGCAAGG - Intronic
1073226154 10:101921324-101921346 GAGGGCATAGTTCTGGGGAAAGG + Intronic
1073374025 10:103017464-103017486 AAGGGCATAGTGACTGGGCAGGG + Intronic
1073559522 10:104485087-104485109 GAGAACTTAGTGAAGGGGCCAGG - Intergenic
1074693164 10:116025360-116025382 GAAAGCATAGAGAAGGGGAAGGG + Intergenic
1074935081 10:118170210-118170232 CAGGGCATAGTGCAGAGGCCTGG + Intergenic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075515001 10:123101504-123101526 GGGGGCATGGGGAAGTGGCAAGG - Intergenic
1075556104 10:123433844-123433866 GAGGCCAGACTGATGGGGCAGGG + Intergenic
1078088478 11:8248922-8248944 GAGGGGGAAGTGAAGGGTCAGGG + Intronic
1078454896 11:11467357-11467379 AAGGGCTCTGTGAAGGGGCAGGG - Intronic
1078662744 11:13300085-13300107 GAGGCCATAGTGCAGGGGAAAGG - Intronic
1078928424 11:15894717-15894739 GACATGATAGTGAAGGGGCAGGG - Intergenic
1079119588 11:17672346-17672368 GGGGGCATAAAGAAGGGGCTGGG + Intergenic
1080695216 11:34597833-34597855 GGGGGTACAGTGAAGGGGAAAGG - Intergenic
1081577500 11:44328339-44328361 CAGGCCAGGGTGAAGGGGCAGGG - Intergenic
1081842872 11:46215877-46215899 GAGGACAGAGAGAATGGGCAAGG - Intergenic
1081911877 11:46705092-46705114 CAGGGCATGGGCAAGGGGCAGGG - Exonic
1083656172 11:64230756-64230778 GGGGGCAGAGGGAAGGGGCCTGG - Exonic
1083815766 11:65131588-65131610 GATGGCATACTGAAGGGAGAGGG + Exonic
1084489635 11:69471383-69471405 GAGGGCATTGGGATGGGGCCGGG - Intergenic
1084861293 11:72020037-72020059 GAGGGCATTTTGGAGGTGCAAGG - Intronic
1085017711 11:73186049-73186071 GAGGGCTGAGTCAAGGGACAGGG + Intergenic
1085758449 11:79221115-79221137 AAAGGCATCCTGAAGGGGCATGG + Intronic
1086002531 11:81999781-81999803 GAGGGCTTAGGGGAGGGGAAAGG + Intergenic
1086192014 11:84091264-84091286 GAGGGCTAAGTCAAGAGGCAAGG - Intronic
1087846051 11:102974213-102974235 GAAGGCAGAGTGAAGGGCTAGGG - Intergenic
1087854075 11:103069601-103069623 GGAGGCCTAGTGAAGGGTCAGGG + Intronic
1089625687 11:119749288-119749310 GTGGGCAAACTGAAGGGGGAGGG + Intergenic
1089752306 11:120660494-120660516 GAGGGCACAGTGCACGGGCTGGG - Intronic
1090563838 11:127964793-127964815 GAGGGCAATGTGTTGGGGCAGGG - Intergenic
1090645784 11:128765560-128765582 GAGGGCATAGGGTATGGGCAGGG - Intronic
1090810221 11:130233168-130233190 GAGAACATATTGATGGGGCAGGG + Exonic
1091192662 11:133707629-133707651 GAAGGTAAAGTGAAGGGGAAGGG + Intergenic
1091332929 11:134744678-134744700 GAGGGGGTAGAGAAGAGGCAAGG + Intergenic
1091413981 12:264095-264117 AAGGGCATGGGGTAGGGGCATGG + Intergenic
1091445206 12:541209-541231 GAGGGCATCGTGCAGGGGTGTGG - Intronic
1091460474 12:640683-640705 GACGACATAGTGAAGAGACAGGG - Intronic
1091864250 12:3817380-3817402 GAAGGCAGAGGGCAGGGGCATGG + Intronic
1093527844 12:20123839-20123861 GAAGGGATAGTGAATGAGCAAGG - Intergenic
1094361131 12:29632484-29632506 GAGTGCCCAGTGAAGGGGAAGGG - Intronic
1094470455 12:30796921-30796943 GAGGGCAGAGTGAAAGGGGTGGG - Intergenic
1095113055 12:38319145-38319167 GAGGACACAGAGAAGGAGCAGGG + Intronic
1095942168 12:47734454-47734476 GGGGGCATGGGGAAAGGGCATGG + Intergenic
1096355548 12:50938105-50938127 GAGGGCATATTGATGGCGGAGGG - Intergenic
1096846321 12:54409016-54409038 GAGGGCATAGGGAAGGAGGTGGG + Intronic
1096872316 12:54601070-54601092 GAGGGCATAGTAAAAGGGTTTGG + Intergenic
1097177638 12:57152566-57152588 GAGGGCCTAGTGCAGGGGTAAGG - Intronic
1097691920 12:62741619-62741641 GGGGTCACAGAGAAGGGGCATGG - Intronic
1098035956 12:66302398-66302420 GAGGGCATGTGGAAGGGGCGGGG - Intergenic
1101446468 12:104740381-104740403 CAGGGCAGAGTGAGAGGGCAGGG - Intronic
1101710047 12:107256738-107256760 GAGGGCTAAAGGAAGGGGCAGGG - Intergenic
1102244787 12:111348324-111348346 GAAGGCAGGGTGAGGGGGCAAGG + Exonic
1103986258 12:124769543-124769565 AAGGGCATGGGGAAGGGGCATGG - Intergenic
1104962203 12:132493642-132493664 CAGGGCACAGAAAAGGGGCAGGG - Intronic
1105651779 13:22386725-22386747 GAGGGAATTGTGCAAGGGCATGG - Intergenic
1108884570 13:55164681-55164703 GAGGGCATTGAGAGTGGGCAGGG + Intergenic
1110530656 13:76593594-76593616 GAGAACATATTGATGGGGCAGGG - Intergenic
1110552862 13:76827909-76827931 GAGGGAAGAGGGAAGGGGGAGGG + Intergenic
1110708754 13:78626707-78626729 GAGGGGCTAGAGAAGAGGCAAGG + Intronic
1112101445 13:96194100-96194122 GAGGGCTTTGAGAATGGGCAGGG - Intronic
1112112854 13:96321888-96321910 GAGTGCAGAGTGAATGGGCCAGG - Intronic
1113247972 13:108420035-108420057 GAGGCCATGGTGATGGGGCTGGG + Intergenic
1114190584 14:20436999-20437021 GTGGGGAAAGTGAAGGGCCAGGG + Intergenic
1115501654 14:34055087-34055109 GAGGGCATGGAGAAGTGGAAGGG + Intronic
1116758553 14:48980708-48980730 CAAGGCTGAGTGAAGGGGCAGGG - Intergenic
1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG + Intergenic
1117099676 14:52333575-52333597 GAGGGCAAAGGGAATGGGGAGGG - Intergenic
1118015133 14:61652822-61652844 AAGGGCAGAGGCAAGGGGCAGGG - Intronic
1119638131 14:76293249-76293271 GAATGCATAGTGCAGGGCCAGGG - Intergenic
1120357329 14:83451293-83451315 TAGGGTATAGTGAAAGGGCCAGG - Intergenic
1121435706 14:93917846-93917868 AAGGGAAAAGTGATGGGGCAGGG - Intergenic
1122879453 14:104683495-104683517 GAGGGGAGAGTGAAGGAGAAGGG + Intergenic
1202845824 14_GL000009v2_random:174008-174030 GAGAAGATAGTGAAGAGGCAAGG - Intergenic
1202915222 14_GL000194v1_random:164276-164298 GAGAAGATAGTGAAGAGGCAAGG - Intergenic
1202877451 14_KI270722v1_random:18441-18463 GAGAAGATAGTGAAGAGGCAAGG + Intergenic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1123918283 15:25053096-25053118 GAGGGCATAGTGCAGGCACATGG + Intergenic
1123920066 15:25063901-25063923 GAGGGCATGGTGCAGGCACATGG + Intergenic
1123971230 15:25509735-25509757 GAGGGGAGAGAGAAGGGCCAGGG + Intergenic
1125729728 15:41886373-41886395 GAGGGCATAGGAAGGGGTCAGGG + Intronic
1125971994 15:43919396-43919418 GAGAGCATAGGAAAGGGGGATGG - Intronic
1126898324 15:53284297-53284319 GATAGCATAGTGAAGAGGAAAGG + Intergenic
1126945598 15:53815819-53815841 GAGAGCATGGTGATGGAGCAGGG + Intergenic
1129205586 15:74035455-74035477 GAGGGCATGGCGAAGGCGGATGG - Intronic
1130220647 15:82016718-82016740 GAGGACAGAGTAAAGGGCCAAGG + Intergenic
1130790623 15:87152349-87152371 GAGGGCATAAGGAAGTGGAAAGG - Intergenic
1131016834 15:89064924-89064946 GAGGGCAATGAGATGGGGCAGGG - Intergenic
1131748618 15:95479896-95479918 GTGGGCATACTGCAGGGGAATGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133424160 16:5673216-5673238 GAAGTCACAGAGAAGGGGCAAGG + Intergenic
1134655995 16:15949224-15949246 GAGGGCACAGTTAAGGCGCCCGG + Intergenic
1135458563 16:22620455-22620477 GGCTGCATAGGGAAGGGGCAGGG + Intergenic
1135624359 16:23981947-23981969 GAAGGGAAAGTGAAGGGGAAGGG - Intronic
1136187670 16:28597576-28597598 GTGGGCAGAGTGAAGGGGCAGGG + Intergenic
1136190149 16:28610556-28610578 GTGGGCAGAGTGAAGGGGCAGGG + Intronic
1136298480 16:29317415-29317437 GTGGGCATAGTGTAGGGATATGG + Intergenic
1136367170 16:29814186-29814208 GAAGGAGGAGTGAAGGGGCAGGG - Intronic
1137776089 16:51055372-51055394 GAGGGTTTAGTGCAGAGGCATGG + Intergenic
1138024347 16:53511201-53511223 GAGGGGATGGTGAAGGGACTGGG + Intergenic
1139576401 16:67845102-67845124 GATTGAATATTGAAGGGGCAAGG + Intronic
1141334116 16:83138862-83138884 GAGGGCACAGTGAAGGGCCATGG + Intronic
1141664404 16:85458459-85458481 GAGGGCATTGGAAGGGGGCATGG + Intergenic
1142509152 17:383877-383899 GAGGGCATCGTGGAGTGGGAAGG + Intronic
1144816963 17:18041079-18041101 AAGGGCAAAGGGAAGGGGAAAGG - Intronic
1144833280 17:18143568-18143590 GAGGGCAGAGTGGAGGTGCCAGG + Exonic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1147657525 17:42099092-42099114 GGGGGCAGAGGGAGGGGGCAGGG - Intergenic
1148184752 17:45634047-45634069 AAAAGCATAGTAAAGGGGCAGGG + Intergenic
1148452650 17:47790075-47790097 GAGTGCACAGGGAAGGCGCAGGG - Intergenic
1148469386 17:47884016-47884038 GAGACCACAGTGAAGTGGCAAGG - Intergenic
1148699333 17:49578496-49578518 CAGGTCAGAGTGAAGTGGCAGGG + Intronic
1150624089 17:66830289-66830311 GAGGGCTGAGTGAGGGGGGAAGG + Intergenic
1151027142 17:70691025-70691047 GAGGCCTGAGTGAAGAGGCAGGG - Intergenic
1151158265 17:72142596-72142618 GAGGGCAGGGGGATGGGGCAGGG + Intergenic
1151717153 17:75836745-75836767 CAGGGCTCAGGGAAGGGGCAGGG - Intronic
1151732887 17:75921563-75921585 GAGGACACAGGGATGGGGCATGG + Intronic
1151758713 17:76088915-76088937 CAGGGCATCCTGAGGGGGCAGGG + Exonic
1153326495 18:3826127-3826149 GAGGGGATGGTGAAGGGCAAGGG + Intronic
1153558218 18:6340568-6340590 GAGAGCATGGCAAAGGGGCAGGG + Intronic
1153715216 18:7840095-7840117 GAGGGCAGGGTGATGGGGGAGGG + Intronic
1154956778 18:21266138-21266160 GAGGGCTTAGTGAATGGAGAAGG - Intronic
1155128213 18:22901738-22901760 GAAGGAAATGTGAAGGGGCAGGG + Intronic
1155681488 18:28492119-28492141 AAGTGCAGAGTGAAGTGGCAGGG - Intergenic
1157275459 18:46308115-46308137 GATGGCATAGTGAAGGCTGAAGG + Intergenic
1157410047 18:47455872-47455894 GGGGGCAGAGTGGTGGGGCAGGG - Intergenic
1157582316 18:48780834-48780856 CAGGGCAGAGTGCAGGGGTAGGG + Intronic
1157726181 18:49965848-49965870 GAGCTCATAGTGAATGGGAAAGG + Intronic
1157867292 18:51197494-51197516 GAGGGCGGGGTGGAGGGGCAGGG + Intronic
1158119343 18:54030880-54030902 GAGGGTATAATAAAAGGGCAGGG - Intergenic
1158375068 18:56854399-56854421 CAAGGCATAGGGAAGGGACATGG + Intronic
1159610708 18:70522490-70522512 GAAGCCATAGCGAAGTGGCAGGG - Intergenic
1159971871 18:74665402-74665424 GAGAGCATGGTGGTGGGGCAGGG + Intronic
1161821449 19:6533299-6533321 GAGGGTTTGGGGAAGGGGCAGGG - Intronic
1161821517 19:6533497-6533519 GAGGGGAGAGGGAAGGGGGAAGG - Intronic
1161957893 19:7506483-7506505 GAGAGGATGGAGAAGGGGCAGGG - Intronic
1163267181 19:16228304-16228326 GAGGCCACAGTGAGGGTGCACGG - Intronic
1163458088 19:17420456-17420478 TAGGGCACCGTGAATGGGCAGGG - Intronic
1163475600 19:17524220-17524242 GAGGGGATAGAGGATGGGCATGG - Intronic
1164540866 19:29120668-29120690 GAAGGCAGAGTGCAGGGGAAAGG - Intergenic
1164695071 19:30237358-30237380 GAGGCCATTGTGAAAGGGCCAGG + Intronic
1165105815 19:33469185-33469207 GTGGCCATAGAGAAGGGCCAGGG - Intronic
1165333568 19:35154582-35154604 GAGGGCATAGTGGTGGGAGAGGG - Intergenic
1165888847 19:39098822-39098844 GAAGGCAGACCGAAGGGGCATGG + Intronic
1166151975 19:40881440-40881462 GAGGCCACAGTGAAGGGAGATGG + Intronic
1166653842 19:44595786-44595808 GAGGTCATAGTTAGGGGCCAGGG + Intergenic
1166690816 19:44820549-44820571 GATGGCATAGGGATGGGGTAGGG - Intronic
1167572522 19:50297979-50298001 GAGGGCATGGGGGAGGGGCATGG + Intronic
1167634918 19:50648891-50648913 GAGAGGATAGAGATGGGGCAAGG + Intronic
1168336375 19:55599687-55599709 GAGGGCAGCGGGAAGGGGCGGGG + Intronic
1168431427 19:56284214-56284236 GGGGGCATTGTGAAGTGGCAAGG - Intronic
1202673228 1_KI270710v1_random:14500-14522 GAGAAGATAGTGAAGAGGCAAGG - Intergenic
925379644 2:3416470-3416492 GAGGGCACAGTGAAGGGGTAGGG - Intronic
925379653 2:3416494-3416516 GAGGGCACAGTGAAGGGGTAGGG - Intronic
925379671 2:3416540-3416562 GAGGGCACAGTGAAGAGGCAGGG - Intronic
925379678 2:3416564-3416586 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379686 2:3416587-3416609 GAGGGCATAGTGAAGGGGCAGGG - Intronic
925379695 2:3416611-3416633 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379703 2:3416634-3416656 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379712 2:3416658-3416680 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379728 2:3416704-3416726 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379737 2:3416728-3416750 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379755 2:3416774-3416796 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379764 2:3416798-3416820 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379782 2:3416844-3416866 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379791 2:3416868-3416890 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379800 2:3416892-3416914 GAGGGCACAGTGAAGGGGCAGGG - Intronic
925379809 2:3416916-3416938 CAGGGCACAGTGAAGGGGCAGGG - Intronic
925413020 2:3650811-3650833 GCAGGCACAGTGAAGGCGCACGG + Intergenic
925593728 2:5535076-5535098 GAGGGCATACTTGAGGGGGAAGG + Intergenic
926300107 2:11596345-11596367 GTGTGCACAGTGAGGGGGCAGGG + Intronic
927343558 2:22010226-22010248 GAGGGGAAAGGGAAGGGGGAGGG - Intergenic
928280074 2:29938154-29938176 GAGGGCAGGGGGAAGGGGGAGGG + Intergenic
928287955 2:30009502-30009524 GAGGTCATGGTGCTGGGGCAAGG + Intergenic
928375168 2:30768098-30768120 GCAGGCACCGTGAAGGGGCAAGG - Intronic
928440257 2:31286191-31286213 AAGGCCAGGGTGAAGGGGCATGG + Intergenic
929667110 2:43841647-43841669 CAGGCCACAGTGAAGGGGCTTGG + Intronic
929982055 2:46690471-46690493 GAGAACAGAGTGAAAGGGCAGGG + Intergenic
930160995 2:48156005-48156027 GAGTGCATTGTGCAGGGGCCTGG + Intergenic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930752261 2:54945224-54945246 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
930752270 2:54945254-54945276 GAGGGGAGAGAGAAGGGGGAGGG - Intronic
931250690 2:60528471-60528493 CTGGGCATATTGAAGGAGCACGG - Intronic
931301634 2:60985340-60985362 GAGGTGATAGTGAAGCAGCAAGG - Intronic
932770543 2:74498542-74498564 GAGGGCATATTGTAGGGGCAAGG + Intronic
934555827 2:95286623-95286645 GAGGGGACAGTGAAAGGGGAGGG + Intronic
934947984 2:98555757-98555779 GAGGGCATGGTGGAGGGGCATGG - Exonic
936818517 2:116489777-116489799 GTGTAGATAGTGAAGGGGCAAGG - Intergenic
937333078 2:121044236-121044258 AAGGGAAGAGGGAAGGGGCAGGG + Intergenic
943720420 2:191198438-191198460 GAGTGCACAGTGATGGCGCATGG - Intergenic
945151996 2:206801352-206801374 GAGGGCCTGGTGATGGGGGAAGG + Intergenic
948167021 2:235870769-235870791 GAGGGCAGAGCCAAGGGCCAAGG - Intronic
948180790 2:235978374-235978396 GAGGGAAGAGTGAAGGGGAAAGG - Intronic
948461980 2:238134233-238134255 AAGGGCATAGCGAGTGGGCAGGG - Intergenic
948501288 2:238396915-238396937 GAGGGCATGGAGAATGTGCAGGG - Intronic
948508416 2:238447032-238447054 GAGAGAATACTGAAGGGGCAAGG - Exonic
948618406 2:239216676-239216698 CAGGGCAGAGTGAAGGCGGAGGG - Intronic
948699507 2:239751191-239751213 GAGGTCATGGTGAAGTGGCCTGG - Intergenic
1168920694 20:1533292-1533314 GAGGTCACAGTGAAGGAACAGGG - Intergenic
1168963296 20:1883340-1883362 GTGGGGAGAGTAAAGGGGCAGGG - Intergenic
1169447977 20:5688376-5688398 GAGGTCAGAGTGAGGGGACATGG - Intergenic
1169585025 20:7072220-7072242 GAGGGCATAAGGAAGGGAAATGG - Intergenic
1171020120 20:21577200-21577222 GAGGCCCTAGTCAAAGGGCAGGG + Intergenic
1171139643 20:22729713-22729735 GAGGGTTTAATGAAGGGGTATGG + Intergenic
1172692043 20:36796752-36796774 GAGGGCAAAGGGGCGGGGCAGGG + Intronic
1173212997 20:41051772-41051794 GTGGGCATTGTGAATGGGTATGG + Intronic
1173577440 20:44122169-44122191 TATGGCATAGTGGAGAGGCAGGG - Intronic
1175100616 20:56576229-56576251 GAGGGCAAGGGGAAGGGGCAGGG - Intergenic
1176269911 20:64230918-64230940 GAGGCCAGAGTGTGGGGGCAAGG + Intronic
1176634574 21:9178922-9178944 GAGAAGATAGTGAAGAGGCAAGG - Intergenic
1176638736 21:9275873-9275895 GAGAAGATAGTGAAGAGGCAAGG + Intergenic
1177853563 21:26377080-26377102 GAGGGTATAGGGAAGAGGGAGGG + Intergenic
1178503936 21:33148116-33148138 AAGGGAAGAATGAAGGGGCAGGG + Intergenic
1178723048 21:35027122-35027144 AAGGGCAGGGTGGAGGGGCAGGG + Intronic
1180370320 22:12028551-12028573 GAGAAGATAGTGAAGAGGCAAGG - Intergenic
1180372039 22:12048717-12048739 GAGAAGATAGTGAAGAGGCAAGG + Intergenic
1180415501 22:12707536-12707558 GAGAAGATAGTGAAGAGGCAAGG + Intergenic
1180422778 22:12883380-12883402 GAGAAGATAGTGAAGAGGCAAGG + Intergenic
1181169110 22:20998355-20998377 AAGAGCATAGTGCAGGGGCAAGG - Exonic
1181382871 22:22520863-22520885 GAGGGGGTAGTGAAGGAGGAGGG - Intergenic
1181473330 22:23154049-23154071 GAAGGCAGAGGGAAGGGGTAAGG - Intronic
1182058817 22:27382186-27382208 GAGGGCAGAGTGAAGGAGGCTGG + Intergenic
1182356321 22:29723749-29723771 GAGGCCAGAGTGGTGGGGCACGG + Intronic
1182754559 22:32668376-32668398 GAGGGGAAAGAGAAGGGGAAAGG - Intronic
1183322730 22:37175051-37175073 AAGTGCAGAGTGAAGGGGGAAGG + Intronic
1183492738 22:38125375-38125397 GAGGGAATGCTGATGGGGCAGGG + Intronic
1183706907 22:39479807-39479829 GAGGGCATTGTGGAGGCCCAGGG + Intronic
1184232598 22:43166709-43166731 GAGGGCCTGTTGCAGGGGCAGGG - Exonic
1184732560 22:46378723-46378745 GAGAGGACAGAGAAGGGGCAGGG + Intronic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
950131571 3:10550804-10550826 GAGGTCATGGTGAAGGCGAAGGG + Intronic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
950915597 3:16641868-16641890 GAGGGAGAAGTGAAGGGGCAAGG - Intronic
951715041 3:25633347-25633369 TAGGGCATAGTACAGGGGAAAGG + Intronic
952737475 3:36704854-36704876 GAGGGCTTATTGAAGGGTCGTGG - Intergenic
954106803 3:48413928-48413950 GAGGGCATGGTGCCGTGGCAGGG + Exonic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
956684576 3:71812907-71812929 GATGGCAGGGTGGAGGGGCAGGG + Intergenic
957196096 3:77070549-77070571 GATGGCATTGTGGATGGGCATGG + Intronic
958128508 3:89387362-89387384 AAGTGCAGAGTGAAGTGGCAGGG - Intronic
960084474 3:113575904-113575926 CAGGGCACATTGGAGGGGCAGGG + Intronic
960445256 3:117740502-117740524 AAGGGCAGAGTGAAGGTGCTTGG - Intergenic
960596382 3:119411522-119411544 GAGGGCAGAGTGAAGTGGAAGGG + Intronic
960694568 3:120383449-120383471 GGAGGCAGAGAGAAGGGGCAGGG + Intergenic
961534190 3:127559519-127559541 GTGGGCATAGGTAAGGGGCCTGG - Intergenic
961549739 3:127662179-127662201 GAAGGCATAGGAAAGGGACAGGG - Intronic
961709971 3:128820598-128820620 AAGGGCATTGTGAAGGCACATGG - Intergenic
962187050 3:133271123-133271145 GAGGGCATGGTGTTGGGGGAAGG - Intronic
963647114 3:147928592-147928614 GAGGGCATGGTGAGTTGGCAGGG - Intergenic
963967694 3:151391436-151391458 GAGGGTACAGGGAAGGGGTATGG - Intronic
964770464 3:160219463-160219485 GAGGGCACAGTGAAAGGGAAGGG + Intergenic
1202748159 3_GL000221v1_random:129146-129168 GAGAAGATAGTGAAGAGGCAAGG - Intergenic
969058368 4:4415839-4415861 GAGGACAGCGTGAAGGGGCGTGG + Intronic
971226414 4:24756802-24756824 GAGGACATACTGAAGGTGCTGGG - Intergenic
971748635 4:30617430-30617452 GGGGTCATGGTGAAGGGTCAAGG + Intergenic
975306689 4:72857503-72857525 GAGCCAAGAGTGAAGGGGCAAGG - Intergenic
978338800 4:107698993-107699015 GAAGGCATAGGGTGGGGGCAAGG + Intronic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
979308023 4:119170399-119170421 GAGGGTATTGTGATTGGGCAGGG + Intronic
980981792 4:139660602-139660624 GATGGCAGAGAGAATGGGCAGGG + Intergenic
980989327 4:139725504-139725526 GAAGGCACAGGGAAGGGTCAGGG - Intronic
983967010 4:173824547-173824569 GATGGCACAGTGAGGGGGAATGG + Intergenic
984488294 4:180400708-180400730 GAGGGCATAGTTAAGGTGTTTGG - Intergenic
984615770 4:181895866-181895888 GCGGGCATGGTGGAGGGGAAAGG - Intergenic
984776436 4:183485261-183485283 GTGGGCATAGAGAAAGAGCAAGG + Intergenic
985006509 4:185539943-185539965 GAGGGGATAGGGATGGAGCAAGG + Intergenic
1202753623 4_GL000008v2_random:34285-34307 GAGAAGATAGTGAAGAGGCAAGG + Intergenic
985733309 5:1563645-1563667 GAGGACATGGTGCAGAGGCATGG - Intergenic
986362395 5:6993107-6993129 GAGGGCAAGGGGAAGGGGAAGGG - Intergenic
987747965 5:22001631-22001653 GAGGGCAGAGGGAAGGAGGAGGG - Intronic
988713761 5:33804244-33804266 GAGCCCAAAGTCAAGGGGCAGGG - Intronic
991768143 5:70011435-70011457 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
991847381 5:70886517-70886539 GAGGGCAGAGGGAAGGAGGAGGG - Intergenic
993695726 5:91059436-91059458 GAGGGTATAATGTAGGGGGAAGG - Intronic
994877504 5:105444613-105444635 GAAGGCACATTGAAGGGGTATGG + Intergenic
994930323 5:106174636-106174658 GAGGGACTAGTGAATGGGTAAGG - Intergenic
995869124 5:116725823-116725845 GAGAGCATAGGGAAAGGGAAAGG - Intergenic
998151231 5:139758683-139758705 GAGGCCAGAGTGAGGAGGCAGGG + Intergenic
998236213 5:140401026-140401048 GAGGGGACAGTCGAGGGGCAAGG - Intergenic
998810007 5:145956760-145956782 GAAAGGATTGTGAAGGGGCAAGG + Intronic
999231686 5:150065571-150065593 GAGTCCCCAGTGAAGGGGCAAGG + Intronic
999238608 5:150114611-150114633 GGGGGCCTGGGGAAGGGGCATGG + Exonic
1000970745 5:167711540-167711562 GTGGGCATTGTGAAAGGCCAGGG - Intronic
1001084436 5:168690550-168690572 CAGGGAAGAATGAAGGGGCAAGG - Intronic
1001403687 5:171461240-171461262 GAGGGCAGTGGGGAGGGGCAGGG + Intergenic
1001635691 5:173208529-173208551 GAGCCCAAAGTCAAGGGGCAGGG + Intergenic
1002535683 5:179874219-179874241 GAGGACCCAGGGAAGGGGCAGGG + Intronic
1002795462 6:467813-467835 GAAGGGATAGTGCAGGCGCAGGG + Intergenic
1003764700 6:9221908-9221930 GAGGGCATCTGGAAAGGGCATGG + Intergenic
1004925425 6:20411443-20411465 GAGGGCAAGGCGAAGGGGAAGGG - Intronic
1005897622 6:30191540-30191562 GAGAGCAGAGTGAAGGGGGATGG + Intronic
1006148086 6:31971106-31971128 GAGGCCATAGTGACGTGGCGGGG - Exonic
1006567608 6:34973841-34973863 GAGGGCAAGGGGAAGGGGAAGGG - Intronic
1006618447 6:35345581-35345603 AAGGCCATGGTGAAGAGGCAAGG - Intronic
1006640372 6:35486405-35486427 GAGGGCAGAGAGCAGGGGGAAGG + Intronic
1006669166 6:35718963-35718985 GAGGGCCTGGAGGAGGGGCAGGG + Intronic
1006801058 6:36759847-36759869 ATGGGCAGAGGGAAGGGGCAGGG + Intronic
1007174765 6:39888136-39888158 GAGGGGATAGGGAAGGGCTATGG + Intronic
1007333712 6:41135984-41136006 GAGGGCACAGTGAATGCCCAAGG + Intergenic
1007665018 6:43508848-43508870 GAGGGCAGGGTGGAGGGCCAGGG + Exonic
1007900221 6:45404411-45404433 GAGGAAGTAGTGAAGAGGCAGGG - Intronic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1009394725 6:63186378-63186400 AAGTGCAGAGTAAAGGGGCAGGG - Intergenic
1011300154 6:85865218-85865240 GATGGCAGTGTGCAGGGGCAGGG - Intergenic
1013163550 6:107569395-107569417 GAGGGCATAGTGCATGTGGAAGG + Intronic
1016544864 6:145209723-145209745 GAGGACACAGAGAATGGGCAGGG + Intergenic
1017913919 6:158818309-158818331 GCGGGCATGGGGAGGGGGCACGG + Intronic
1018205733 6:161435956-161435978 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205744 6:161435983-161436005 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1018205755 6:161436010-161436032 GAGGGCAGAGAGGAGGGGGAGGG + Intronic
1019620384 7:1988890-1988912 GTGGGCCTTGGGAAGGGGCATGG - Intronic
1021040567 7:15857102-15857124 TGTGGCATAGTGAAGAGGCAGGG + Intergenic
1021213794 7:17890034-17890056 GAGGGTCTAGGGAAGGGGGAGGG + Intronic
1022254218 7:28640003-28640025 GAGGCCAGAGTGAAGAGGCATGG - Intronic
1022257009 7:28668927-28668949 CAGGGCAGAGTGAAAGGACAAGG - Intronic
1022592898 7:31682987-31683009 GAGGGTAAAGGGAAGGGGCATGG + Intergenic
1023024958 7:36041937-36041959 GAGGATCTAGTGAAGGAGCAGGG + Intergenic
1023320732 7:38994787-38994809 GAGGGCATTGTGAATTGGAATGG - Intronic
1023911133 7:44557656-44557678 GAGGGAAAAGGGAAGGGGAAGGG + Intergenic
1024178472 7:46864085-46864107 CAGGGCACAGTGAAGGTGGAGGG - Intergenic
1024185723 7:46946097-46946119 GAGGTCACAGGGAAGGGGCAGGG + Intergenic
1024654154 7:51434906-51434928 AAGGGGAGAGTGAGGGGGCATGG - Intergenic
1025106952 7:56179249-56179271 AAGGTGATAGTGAAAGGGCATGG + Intergenic
1025986904 7:66461807-66461829 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1026511930 7:71034536-71034558 GAGAGCAAAGTGAAGAAGCAGGG - Intergenic
1026857172 7:73762527-73762549 GGGGGCTCAGTGAAGGGGCCGGG - Intergenic
1027171839 7:75878361-75878383 AAGGGCATTGTGAAGGGTGAGGG + Intronic
1027210174 7:76140644-76140666 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1027773512 7:82435974-82435996 CATTGCATACTGAAGGGGCATGG - Intronic
1028399675 7:90411259-90411281 CAGAGCATGATGAAGGGGCAAGG - Intronic
1028966467 7:96807204-96807226 GAGGAGAAAGTGAAGGGGGAAGG + Intergenic
1031866112 7:127039948-127039970 GAGGGGATGGGGAAGGGGTATGG + Intronic
1032083989 7:128874210-128874232 GAGGGCAAGCGGAAGGGGCAGGG - Intronic
1032086112 7:128884752-128884774 GAGGGCACAGTGGTGGGGCTGGG - Intronic
1032389367 7:131546073-131546095 GAGGGCATGGGGGAGGTGCATGG - Intronic
1032527981 7:132594174-132594196 GAGGTCATACTGGAGGAGCATGG + Intronic
1034056650 7:148042356-148042378 CAGGGCATGGTGGAGGGGGAAGG + Intronic
1034531280 7:151697664-151697686 GGGGGCACAGAGAATGGGCACGG + Intronic
1034635660 7:152565520-152565542 GAGGGAAGAGGGAAGAGGCAGGG - Intergenic
1034746326 7:153526972-153526994 GAGGGAATAGAGAAGTGGCGGGG + Intergenic
1035316228 7:157999074-157999096 GTGGGCATAGTGTAGGGGCCAGG - Intronic
1035389848 7:158496990-158497012 GAGGGCGCAGGGAAGGGGGAGGG - Intronic
1036933906 8:12982239-12982261 GAGGTGATAGGGAAGGGGCAGGG + Intronic
1038247820 8:25875404-25875426 GATGACAGAGTGAAGAGGCAGGG - Intronic
1039123047 8:34170160-34170182 GAGGGAATAGCAAATGGGCAGGG + Intergenic
1040979650 8:53233474-53233496 CAGGTCATAGTGAAAGGGCAAGG - Intronic
1041586773 8:59529834-59529856 GAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1041738964 8:61139057-61139079 GAGGGCATCCTGGAGAGGCAAGG - Intronic
1042273629 8:66980710-66980732 AAGGACATAGTGAAGGGGCTAGG - Intronic
1043322659 8:79009378-79009400 GAGGGAAGAGGGAAGGGGGAAGG - Intergenic
1043322681 8:79009432-79009454 GAGGGAAGAGGGAAGGGGGAAGG - Intergenic
1043973837 8:86563371-86563393 GAGGGCAGAGTGGAAGGGTATGG - Intronic
1044476720 8:92635078-92635100 GAGGGCAATGTGCAGGGGCGTGG - Intergenic
1045178891 8:99758748-99758770 GAGGGCAAAGTGGAAGGGCATGG - Intronic
1045326810 8:101123271-101123293 GAGGGGAGAGAGATGGGGCAAGG + Intergenic
1047011252 8:120674569-120674591 ATGGGCCTAGTGATGGGGCAAGG + Intronic
1047301378 8:123616365-123616387 GAAGGCAGAGTGAAGGGGATGGG + Intergenic
1049068682 8:140339704-140339726 GAAGCCATAGTGAAGTGGTAGGG - Intronic
1049174462 8:141183030-141183052 CAGGGCAGTGTGAAGGGGCGAGG - Intronic
1049585841 8:143432067-143432089 GAGGGCCCAGGGAAGGGCCAGGG - Intergenic
1049672762 8:143877211-143877233 CAGGGCCCAGGGAAGGGGCAGGG - Intronic
1049944939 9:585148-585170 GAAGACACAGTGAAGGGTCAAGG - Intronic
1051602096 9:18885568-18885590 GAGGGCACTGTCAAGTGGCATGG + Intronic
1051871150 9:21739020-21739042 CAGGGCATAGTGCTGGGGAAAGG + Intergenic
1052458210 9:28728241-28728263 TAGGGCACAGTGAAGGGGAGGGG - Intergenic
1052747829 9:32458152-32458174 GGGGGCACAGTGGAGGGGCTGGG - Intronic
1053313249 9:37032663-37032685 GAGGGCACAGAGATGGGGGAAGG + Intronic
1054810848 9:69432753-69432775 AAGAGCAGAGTGTAGGGGCAGGG - Intronic
1055621115 9:78126068-78126090 GGAGGCAAAGTGAAGGGGCCAGG - Intergenic
1057892596 9:98880613-98880635 GAGGGCTTAGTGATGAGGCCAGG + Intergenic
1058813639 9:108664556-108664578 GAGTGCAGAGTGCAAGGGCAGGG - Intergenic
1060243396 9:121924375-121924397 GAGGGCAGAGAAAAGAGGCAAGG + Intronic
1060836971 9:126763388-126763410 GAGGCCACAGTGCAGGAGCACGG - Intergenic
1060877663 9:127094893-127094915 GAGGGCAGAGTTGATGGGCAGGG - Intronic
1061322488 9:129839882-129839904 AGGGGCAAAGTGGAGGGGCAAGG - Intronic
1061360411 9:130138436-130138458 GAGGGGATGGGGAAGGGGGAAGG - Exonic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1062098035 9:134712660-134712682 GAGGGCAGAAGGAAGGGGTAAGG - Intronic
1062107602 9:134764263-134764285 GAGGGCATTGTGGGGGGTCAAGG + Intronic
1062613836 9:137387197-137387219 GAGGCCACAGTGAAGCGACAGGG - Intronic
1203757410 Un_GL000218v1:146556-146578 GAGAAGATAGTGAAGAGGCAAGG - Intergenic
1203716799 Un_KI270742v1:159228-159250 GAGAAGATAGTGAAGAGGCAAGG - Intergenic
1203534412 Un_KI270743v1:19008-19030 GAGAAGATAGTGAAGAGGCAAGG + Intergenic
1203651027 Un_KI270751v1:122811-122833 GAGAAGATAGTGAAGAGGCAAGG - Intergenic
1185537383 X:872962-872984 GAGGGGAAAGGGAAGGGGAAGGG - Intergenic
1187003589 X:15208022-15208044 GAGGGGTTCGTGAAGGGGTATGG - Intergenic
1187043013 X:15616839-15616861 GTGGGCATGGTGGAGGGGCGGGG - Intergenic
1188013928 X:25086861-25086883 AAGGGCATAGAGTAGGGGCCAGG + Intergenic
1188316023 X:28674353-28674375 GAGTGCATAGGGAAGGGGGGTGG - Intronic
1190823208 X:53993699-53993721 GAAGGCAGAGCGAAAGGGCAAGG - Exonic
1191111188 X:56804050-56804072 GGGGGCAATGTGAAGGGGTATGG + Intergenic
1192207318 X:69105094-69105116 GAAGGCAAGGTGAAGGGGCCGGG + Intergenic
1195356267 X:104042603-104042625 GAGTGAAGAGTGAGGGGGCAAGG + Intergenic
1196004032 X:110816597-110816619 GAGGGGAGAGTGATGGGGGAAGG + Intergenic
1198618101 X:138480350-138480372 CAGGGCTGACTGAAGGGGCAGGG - Intergenic
1198972792 X:142300240-142300262 GAGGACAAAGGGAAGTGGCAGGG + Intergenic
1200048861 X:153417838-153417860 GAGGTCATACTGTAGGAGCAGGG + Intergenic
1200114971 X:153765970-153765992 GAGGGGTCAGGGAAGGGGCAGGG - Intronic
1200212079 X:154351220-154351242 GACGGCAGAGTGTGGGGGCAGGG - Intronic
1201170994 Y:11264175-11264197 GAGAAGATAGTGAAGAGGCAAGG - Intergenic
1202097820 Y:21272159-21272181 GAGGGCATGGTGAAGTGATACGG - Intergenic