ID: 925381345

View in Genome Browser
Species Human (GRCh38)
Location 2:3428798-3428820
Sequence GACCTCAGCTCCGGGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925381345_925381354 -6 Left 925381345 2:3428798-3428820 CCCGCGCCCCCGGAGCTGAGGTC 0: 1
1: 0
2: 1
3: 14
4: 150
Right 925381354 2:3428815-3428837 GAGGTCTGTGCGGTTCTGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 175
925381345_925381355 -5 Left 925381345 2:3428798-3428820 CCCGCGCCCCCGGAGCTGAGGTC 0: 1
1: 0
2: 1
3: 14
4: 150
Right 925381355 2:3428816-3428838 AGGTCTGTGCGGTTCTGGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 141
925381345_925381352 -10 Left 925381345 2:3428798-3428820 CCCGCGCCCCCGGAGCTGAGGTC 0: 1
1: 0
2: 1
3: 14
4: 150
Right 925381352 2:3428811-3428833 AGCTGAGGTCTGTGCGGTTCTGG 0: 1
1: 0
2: 0
3: 12
4: 141
925381345_925381360 21 Left 925381345 2:3428798-3428820 CCCGCGCCCCCGGAGCTGAGGTC 0: 1
1: 0
2: 1
3: 14
4: 150
Right 925381360 2:3428842-3428864 CCCAAAGCCACAAGAAGCCCAGG 0: 1
1: 1
2: 3
3: 38
4: 697
925381345_925381353 -9 Left 925381345 2:3428798-3428820 CCCGCGCCCCCGGAGCTGAGGTC 0: 1
1: 0
2: 1
3: 14
4: 150
Right 925381353 2:3428812-3428834 GCTGAGGTCTGTGCGGTTCTGGG 0: 1
1: 0
2: 2
3: 9
4: 160
925381345_925381356 -4 Left 925381345 2:3428798-3428820 CCCGCGCCCCCGGAGCTGAGGTC 0: 1
1: 0
2: 1
3: 14
4: 150
Right 925381356 2:3428817-3428839 GGTCTGTGCGGTTCTGGGTGGGG 0: 1
1: 0
2: 0
3: 19
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925381345 Original CRISPR GACCTCAGCTCCGGGGGCGC GGG (reversed) Intronic