ID: 925382122

View in Genome Browser
Species Human (GRCh38)
Location 2:3435813-3435835
Sequence GCATTCATTACATATCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925382122_925382123 13 Left 925382122 2:3435813-3435835 CCTGTGTGATATGTAATGAATGC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 925382123 2:3435849-3435871 CTAATTACCTGTTATAATGAAGG 0: 1
1: 0
2: 1
3: 10
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925382122 Original CRISPR GCATTCATTACATATCACAC AGG (reversed) Intronic
904842380 1:33381069-33381091 GCATTCAGTGCATATTTCACAGG - Intronic
906354926 1:45096811-45096833 TTCTCCATTACATATCACACTGG + Intronic
907732208 1:57077533-57077555 TAATTCATAACATTTCACACAGG + Intronic
917024171 1:170624171-170624193 TCATGCTTTACATATCACTCAGG + Intergenic
917775046 1:178324549-178324571 ACCTTCATTACATAACAGACTGG - Intronic
918778060 1:188663797-188663819 GCCTTCATTACATAACACATTGG + Intergenic
918901109 1:190419160-190419182 GCATTCTTTTCATATCAAAAGGG + Intronic
919011417 1:191969920-191969942 GCATTTCTTACATATCTCACAGG + Intergenic
924491768 1:244545033-244545055 CCTTTCATAAGATATCACACTGG + Intronic
924899304 1:248378637-248378659 TCATCCTTTACATTTCACACTGG + Intergenic
1063285466 10:4682991-4683013 GCATTCACGACAAAACACACAGG - Intergenic
1065006038 10:21381311-21381333 ATTTTCATTACATCTCACACTGG + Intergenic
1072456918 10:95584531-95584553 GCAATCAGTACATGCCACACTGG - Intergenic
1073625585 10:105092562-105092584 GCACTCATTGCATACCACAAAGG - Intronic
1074481538 10:113825954-113825976 GCTCTGATTACATATCACATGGG - Intergenic
1075176045 10:120162275-120162297 GTATTAATTATATATAACACTGG + Intergenic
1078904055 11:15667917-15667939 GCATTCATCACATTTCCCCCTGG + Intergenic
1087188193 11:95224944-95224966 GCATCCATTGCATAGCAAACTGG - Intronic
1088931096 11:114351472-114351494 GCATCCATTTCATATTACAAAGG - Intergenic
1090896607 11:130982174-130982196 GCGAACATTACATATCACACAGG + Intergenic
1092129332 12:6097838-6097860 TCAGTCACTCCATATCACACAGG + Intronic
1094569747 12:31631293-31631315 GCATGCAGTACCCATCACACGGG - Intergenic
1095254790 12:40022296-40022318 ACATAGATTACATATCACACAGG + Intronic
1099709588 12:86206060-86206082 ACATTCATTCCATAGCACATTGG - Intronic
1103023212 12:117553440-117553462 ACATTCATTAAGTATCACTCTGG + Intronic
1103841209 12:123866573-123866595 CCAATCATTACCTATCCCACTGG - Intronic
1105609219 13:21953327-21953349 GCCTTCATGACAAAACACACAGG - Intergenic
1109943456 13:69401884-69401906 GCATTCACTATATATTACAAAGG + Intergenic
1117216763 14:53559594-53559616 GCTTTCAAAAGATATCACACTGG + Intergenic
1118079304 14:62339871-62339893 AAATGCATTACAGATCACACAGG + Intergenic
1121877682 14:97468696-97468718 GCATTTATTATATATTAAACTGG + Intergenic
1122301222 14:100732196-100732218 GCATTCATTAGATCACACACAGG - Intronic
1123138024 14:106048456-106048478 GCATCCATTACATCACAGACTGG + Intergenic
1124179241 15:27457145-27457167 GCATTCATTAGAGACCACAGTGG + Intronic
1126321780 15:47431713-47431735 GCATTCAAAACAGATCACACAGG - Intronic
1131477418 15:92752085-92752107 GCCTTCATTACAAACCACAGGGG + Intronic
1131912006 15:97216732-97216754 GCATCTATTAAACATCACACTGG - Intergenic
1138724646 16:59122801-59122823 GCATTATTTACTTATCACAAAGG + Intergenic
1139044400 16:63039059-63039081 AGATTTATTTCATATCACACTGG + Intergenic
1143322575 17:6077615-6077637 GGATTCAATACATCTCACACAGG - Intronic
1146531922 17:33614983-33615005 GCATTAATTACAAGTCAAACTGG + Intronic
1151117955 17:71759638-71759660 GCTATCATTGCATATCCCACAGG + Intergenic
1153217776 18:2836197-2836219 GCTTCCACTAGATATCACACTGG - Intergenic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1157177108 18:45461662-45461684 CCCTTCATGTCATATCACACAGG - Intronic
1159142729 18:64417413-64417435 GTATCATTTACATATCACACAGG - Intergenic
925382122 2:3435813-3435835 GCATTCATTACATATCACACAGG - Intronic
926288826 2:11512434-11512456 GCATTCATTACTAAATACACAGG - Intergenic
927732174 2:25483305-25483327 GCATTCATTGTATATTACAAAGG + Intronic
930421732 2:51162395-51162417 GCCCTCATTACATTTCTCACAGG + Intergenic
936646362 2:114376947-114376969 CCTTTCATGAAATATCACACTGG - Intergenic
937743543 2:125384352-125384374 CCATTCTTTAAATATCATACTGG + Intergenic
937825916 2:126368442-126368464 GCATTGCTTACGTAACACACTGG - Intergenic
938645857 2:133329355-133329377 GCATGCCTTAAATATCTCACAGG + Intronic
941689877 2:168489760-168489782 CCATTCATTCCATATCACCATGG + Intronic
943793567 2:191964043-191964065 TCATACTGTACATATCACACTGG - Intronic
944560614 2:200933398-200933420 GTATTCACTAAATCTCACACTGG - Intronic
945836245 2:214838892-214838914 GCATGCAATGCACATCACACAGG + Intergenic
1168790222 20:571397-571419 ACTTTCATTTCATATCACAGTGG - Intergenic
1170439124 20:16359906-16359928 CTCTTCATTACATATCATACTGG + Intronic
1171235391 20:23520309-23520331 GCAATGATTACATAAGACACAGG + Intergenic
1179221646 21:39413115-39413137 ACATTCAGTACACATCAGACAGG + Intronic
949739787 3:7218469-7218491 GTATTATTTACATATCAGACAGG - Intronic
950617789 3:14176081-14176103 GCAGTTATTACATTTCACAGAGG + Intronic
951392294 3:22121312-22121334 CCCTTCATTTCCTATCACACAGG + Intronic
953083064 3:39639216-39639238 GCAGTCATTACATCTCACTTGGG + Intergenic
953789927 3:45939501-45939523 GCAGTAATTACATAACAAACAGG - Intronic
955209659 3:56928877-56928899 AAATGCATTACATAACACACGGG + Intronic
957607012 3:82413342-82413364 GCACTGATTACATTTCACAGTGG + Intergenic
961718462 3:128875501-128875523 CCATGCACTACATATCTCACTGG + Intergenic
963454409 3:145524839-145524861 CAATTCATTACACATCATACTGG - Intergenic
965122391 3:164577922-164577944 GAATTTATTTCATATCCCACTGG + Intergenic
967670484 3:192228306-192228328 GCATGCATTACCCATCACAGTGG + Intronic
967831689 3:193925403-193925425 GCTTTCACAAGATATCACACTGG + Intergenic
971730299 4:30370440-30370462 GCATTCATCACCTTTCATACCGG + Intergenic
972967796 4:44533415-44533437 TCATTCATTACATGACACATTGG + Intergenic
978057253 4:104286276-104286298 GCATTCATTGAATAACACATTGG + Intergenic
979425529 4:120560608-120560630 GCTTTCATCACATATCATAATGG - Intergenic
982508620 4:156251876-156251898 GGATTCTTGACATACCACACTGG + Intergenic
988169273 5:27633402-27633424 GCTTCCATGAGATATCACACTGG - Intergenic
992664182 5:78989855-78989877 GAATTCTTTATATATTACACAGG + Intergenic
996825481 5:127677242-127677264 GCTTTCACAAGATATCACACTGG + Intergenic
999297168 5:150466992-150467014 GCCTTCATCACATCTCACCCAGG + Intergenic
1002301959 5:178262441-178262463 TCATCCATTACTTGTCACACCGG - Intronic
1003202604 6:3976047-3976069 CCACTCATTTCCTATCACACTGG + Intergenic
1007863675 6:44942759-44942781 GCATGCATTTCATACCATACAGG - Intronic
1007973302 6:46074964-46074986 GCATTCAGTAAATATCCTACTGG - Intronic
1008699148 6:54078216-54078238 ACATTTATAAAATATCACACAGG + Intronic
1009050323 6:58267412-58267434 GCCTTCATTGCAAATCCCACAGG + Intergenic
1009240089 6:61174981-61175003 GCCTTCATTGCAAATCCCACAGG - Intergenic
1009288141 6:61848984-61849006 ACAATCATTACATATCACACAGG + Intronic
1009830331 6:68922211-68922233 GCACCCATTACATTCCACACAGG - Intronic
1010580834 6:77594503-77594525 GCTTTCACAAAATATCACACTGG - Intergenic
1012021945 6:93933806-93933828 GCATTCATTACATATTTGCCAGG + Intergenic
1012416353 6:99018013-99018035 GCATTCTCCACATACCACACTGG - Intergenic
1016115248 6:140274042-140274064 CCATTCATTACATAACTCATTGG - Intergenic
1016115316 6:140275582-140275604 CCATTCATTACATAACTCACTGG + Intergenic
1017533064 6:155316115-155316137 TCAGTCATTACATGGCACACTGG - Intergenic
1017611091 6:156186971-156186993 GCATTCATTTCATACCGCAGGGG - Intergenic
1018105631 6:160483597-160483619 GCATTAATTCCATATCGCCCTGG - Intergenic
1018117365 6:160600450-160600472 GCATTAATTCCATATCTCCCTGG - Intronic
1018117910 6:160606004-160606026 GCATTAATTCCAAATCACCCTGG - Intronic
1027899938 7:84099467-84099489 GCATTGATAGCATATCACAAAGG - Intronic
1028003397 7:85530644-85530666 ACATTCATTTCATATCACAGTGG - Intergenic
1028259679 7:88647050-88647072 AATTTCATTACATTTCACACTGG + Intergenic
1031676484 7:124617756-124617778 GCTTCCATAAGATATCACACTGG + Intergenic
1033169375 7:139070204-139070226 GTATTCATTAAATGTGACACAGG - Intronic
1033374876 7:140749520-140749542 GAATTGATTACATATTAGACAGG - Intronic
1035888764 8:3322002-3322024 GCTTTCATTACATATCAGTGTGG + Intronic
1038343395 8:26708886-26708908 GCAGTCATTACATTTCTCCCTGG + Intergenic
1039950287 8:42166083-42166105 TGATTCATTCCACATCACACGGG - Intronic
1048356243 8:133656314-133656336 GCGTTCAGTACATAACACAAAGG - Intergenic
1050742885 9:8842730-8842752 GCATTAATTACATGTGACATTGG + Intronic
1051056696 9:12995591-12995613 GCATTGATAACATCTCACAGTGG - Intergenic
1052119533 9:24694294-24694316 GCTTTCTGTACATAACACACAGG + Intergenic
1052173973 9:25434241-25434263 GCATTCAGTCCATACTACACTGG + Intergenic
1055365503 9:75540133-75540155 GCATTCTTTAGATATGATACTGG - Intergenic
1056728048 9:89139619-89139641 CCATTCTTTACTTATCACACAGG + Intronic
1059052347 9:110939678-110939700 TCATTCAGTACATTGCACACTGG + Intronic
1188688400 X:33098594-33098616 ACATTGTTTACATATAACACAGG - Intronic
1189052960 X:37665647-37665669 GCATTTATTCAATATCACCCAGG + Intronic