ID: 925386176

View in Genome Browser
Species Human (GRCh38)
Location 2:3463389-3463411
Sequence TCGGGGGCCCCTGCACCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925386176_925386184 11 Left 925386176 2:3463389-3463411 CCGGCGGGTGCAGGGGCCCCCGA 0: 1
1: 0
2: 0
3: 5
4: 133
Right 925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 352
925386176_925386183 6 Left 925386176 2:3463389-3463411 CCGGCGGGTGCAGGGGCCCCCGA 0: 1
1: 0
2: 0
3: 5
4: 133
Right 925386183 2:3463418-3463440 TTCTCTGCCGCGCCTGCCCCCGG 0: 1
1: 0
2: 2
3: 13
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925386176 Original CRISPR TCGGGGGCCCCTGCACCCGC CGG (reversed) Intronic