ID: 925386177

View in Genome Browser
Species Human (GRCh38)
Location 2:3463405-3463427
Sequence CGGCAGAGAAGGGATCTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925386177_925386192 17 Left 925386177 2:3463405-3463427 CCCCCGAGATCCCTTCTCTGCCG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187
925386177_925386183 -10 Left 925386177 2:3463405-3463427 CCCCCGAGATCCCTTCTCTGCCG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 925386183 2:3463418-3463440 TTCTCTGCCGCGCCTGCCCCCGG 0: 1
1: 0
2: 2
3: 13
4: 210
925386177_925386194 25 Left 925386177 2:3463405-3463427 CCCCCGAGATCCCTTCTCTGCCG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386177_925386184 -5 Left 925386177 2:3463405-3463427 CCCCCGAGATCCCTTCTCTGCCG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925386177 Original CRISPR CGGCAGAGAAGGGATCTCGG GGG (reversed) Intronic