ID: 925386179

View in Genome Browser
Species Human (GRCh38)
Location 2:3463407-3463429
Sequence CGCGGCAGAGAAGGGATCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925386179_925386192 15 Left 925386179 2:3463407-3463429 CCCGAGATCCCTTCTCTGCCGCG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187
925386179_925386184 -7 Left 925386179 2:3463407-3463429 CCCGAGATCCCTTCTCTGCCGCG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 352
925386179_925386194 23 Left 925386179 2:3463407-3463429 CCCGAGATCCCTTCTCTGCCGCG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925386179 Original CRISPR CGCGGCAGAGAAGGGATCTC GGG (reversed) Intronic