ID: 925386180

View in Genome Browser
Species Human (GRCh38)
Location 2:3463408-3463430
Sequence GCGCGGCAGAGAAGGGATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925386180_925386194 22 Left 925386180 2:3463408-3463430 CCGAGATCCCTTCTCTGCCGCGC 0: 1
1: 0
2: 0
3: 18
4: 155
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386180_925386192 14 Left 925386180 2:3463408-3463430 CCGAGATCCCTTCTCTGCCGCGC 0: 1
1: 0
2: 0
3: 18
4: 155
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187
925386180_925386184 -8 Left 925386180 2:3463408-3463430 CCGAGATCCCTTCTCTGCCGCGC 0: 1
1: 0
2: 0
3: 18
4: 155
Right 925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925386180 Original CRISPR GCGCGGCAGAGAAGGGATCT CGG (reversed) Intronic