ID: 925386184

View in Genome Browser
Species Human (GRCh38)
Location 2:3463423-3463445
Sequence TGCCGCGCCTGCCCCCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 352}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925386177_925386184 -5 Left 925386177 2:3463405-3463427 CCCCCGAGATCCCTTCTCTGCCG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 352
925386180_925386184 -8 Left 925386180 2:3463408-3463430 CCGAGATCCCTTCTCTGCCGCGC 0: 1
1: 0
2: 0
3: 18
4: 155
Right 925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 352
925386176_925386184 11 Left 925386176 2:3463389-3463411 CCGGCGGGTGCAGGGGCCCCCGA 0: 1
1: 0
2: 0
3: 5
4: 133
Right 925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 352
925386178_925386184 -6 Left 925386178 2:3463406-3463428 CCCCGAGATCCCTTCTCTGCCGC 0: 1
1: 0
2: 0
3: 13
4: 194
Right 925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 352
925386179_925386184 -7 Left 925386179 2:3463407-3463429 CCCGAGATCCCTTCTCTGCCGCG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 925386184 2:3463423-3463445 TGCCGCGCCTGCCCCCGGCCTGG 0: 1
1: 0
2: 1
3: 23
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925386184 Original CRISPR TGCCGCGCCTGCCCCCGGCC TGG Intronic