ID: 925386192

View in Genome Browser
Species Human (GRCh38)
Location 2:3463445-3463467
Sequence GAATCCAGCTTCCTCTCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 187}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925386185_925386192 -3 Left 925386185 2:3463425-3463447 CCGCGCCTGCCCCCGGCCTGGAA 0: 1
1: 0
2: 3
3: 37
4: 449
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187
925386181_925386192 7 Left 925386181 2:3463415-3463437 CCCTTCTCTGCCGCGCCTGCCCC 0: 1
1: 0
2: 4
3: 42
4: 392
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187
925386179_925386192 15 Left 925386179 2:3463407-3463429 CCCGAGATCCCTTCTCTGCCGCG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187
925386180_925386192 14 Left 925386180 2:3463408-3463430 CCGAGATCCCTTCTCTGCCGCGC 0: 1
1: 0
2: 0
3: 18
4: 155
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187
925386177_925386192 17 Left 925386177 2:3463405-3463427 CCCCCGAGATCCCTTCTCTGCCG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187
925386178_925386192 16 Left 925386178 2:3463406-3463428 CCCCGAGATCCCTTCTCTGCCGC 0: 1
1: 0
2: 0
3: 13
4: 194
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187
925386182_925386192 6 Left 925386182 2:3463416-3463438 CCTTCTCTGCCGCGCCTGCCCCC 0: 1
1: 0
2: 4
3: 43
4: 536
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187
925386186_925386192 -8 Left 925386186 2:3463430-3463452 CCTGCCCCCGGCCTGGAATCCAG 0: 1
1: 0
2: 3
3: 32
4: 373
Right 925386192 2:3463445-3463467 GAATCCAGCTTCCTCTCACACGG 0: 1
1: 0
2: 4
3: 21
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925386192 Original CRISPR GAATCCAGCTTCCTCTCACA CGG Intronic