ID: 925386194

View in Genome Browser
Species Human (GRCh38)
Location 2:3463453-3463475
Sequence CTTCCTCTCACACGGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 213}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925386182_925386194 14 Left 925386182 2:3463416-3463438 CCTTCTCTGCCGCGCCTGCCCCC 0: 1
1: 0
2: 4
3: 43
4: 536
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386187_925386194 -4 Left 925386187 2:3463434-3463456 CCCCCGGCCTGGAATCCAGCTTC 0: 1
1: 0
2: 3
3: 11
4: 184
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386177_925386194 25 Left 925386177 2:3463405-3463427 CCCCCGAGATCCCTTCTCTGCCG 0: 1
1: 0
2: 1
3: 8
4: 145
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386186_925386194 0 Left 925386186 2:3463430-3463452 CCTGCCCCCGGCCTGGAATCCAG 0: 1
1: 0
2: 3
3: 32
4: 373
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386180_925386194 22 Left 925386180 2:3463408-3463430 CCGAGATCCCTTCTCTGCCGCGC 0: 1
1: 0
2: 0
3: 18
4: 155
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386181_925386194 15 Left 925386181 2:3463415-3463437 CCCTTCTCTGCCGCGCCTGCCCC 0: 1
1: 0
2: 4
3: 42
4: 392
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386189_925386194 -6 Left 925386189 2:3463436-3463458 CCCGGCCTGGAATCCAGCTTCCT 0: 1
1: 1
2: 3
3: 52
4: 418
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386190_925386194 -7 Left 925386190 2:3463437-3463459 CCGGCCTGGAATCCAGCTTCCTC 0: 1
1: 0
2: 7
3: 41
4: 415
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386178_925386194 24 Left 925386178 2:3463406-3463428 CCCCGAGATCCCTTCTCTGCCGC 0: 1
1: 0
2: 0
3: 13
4: 194
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386179_925386194 23 Left 925386179 2:3463407-3463429 CCCGAGATCCCTTCTCTGCCGCG 0: 1
1: 0
2: 0
3: 5
4: 93
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386185_925386194 5 Left 925386185 2:3463425-3463447 CCGCGCCTGCCCCCGGCCTGGAA 0: 1
1: 0
2: 3
3: 37
4: 449
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213
925386188_925386194 -5 Left 925386188 2:3463435-3463457 CCCCGGCCTGGAATCCAGCTTCC 0: 1
1: 0
2: 0
3: 37
4: 249
Right 925386194 2:3463453-3463475 CTTCCTCTCACACGGCTCCCAGG 0: 1
1: 0
2: 0
3: 16
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925386194 Original CRISPR CTTCCTCTCACACGGCTCCC AGG Intronic