ID: 925386774

View in Genome Browser
Species Human (GRCh38)
Location 2:3467554-3467576
Sequence AACCCAGCCCCAGTAAGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
925386773_925386774 -5 Left 925386773 2:3467536-3467558 CCATCTGCACATACAGAAAACCC 0: 1
1: 0
2: 1
3: 19
4: 187
Right 925386774 2:3467554-3467576 AACCCAGCCCCAGTAAGTTCCGG 0: 1
1: 0
2: 0
3: 22
4: 129
925386772_925386774 20 Left 925386772 2:3467511-3467533 CCTCGCGCAGCTGACGACTGCAT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 925386774 2:3467554-3467576 AACCCAGCCCCAGTAAGTTCCGG 0: 1
1: 0
2: 0
3: 22
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
925386774 Original CRISPR AACCCAGCCCCAGTAAGTTC CGG Intronic
900228515 1:1544084-1544106 AGCCCAGCCCCAGTGGTTTCTGG + Intronic
902551847 1:17224038-17224060 AACCCAGCCCCTGCAACCTCAGG + Intronic
905781418 1:40713659-40713681 AATTGAGGCCCAGTAAGTTCAGG + Intronic
907834324 1:58094541-58094563 CACCCAGCCTCTTTAAGTTCTGG + Intronic
911793893 1:102053284-102053306 AACCCTCCCCAAGTCAGTTCCGG - Intergenic
914046660 1:144099350-144099372 AACCCTGCCCCAGAAAGTCCAGG - Intergenic
914131450 1:144861336-144861358 AACCCTGCCCCAGAAAGTCCAGG + Intergenic
917075596 1:171201243-171201265 AACAGAGCCTCAGTAAATTCTGG + Intronic
917485264 1:175449718-175449740 AATCCAGCCCAAGTCAGTTGGGG - Intronic
919132685 1:193471126-193471148 AACCAAGCCCCATTTATTTCTGG + Intergenic
919188236 1:194182105-194182127 AACCCAGCCACAGAGATTTCCGG + Intergenic
920984543 1:210873612-210873634 AACTCAGCCCCCCAAAGTTCTGG + Intronic
924257176 1:242194034-242194056 GACCCATCCGCAGTGAGTTCTGG + Intronic
1064361970 10:14674368-14674390 AACACAGCCCCTGTATATTCTGG - Intronic
1065522265 10:26584408-26584430 AAGCCAGCCCCAGTCAGGGCTGG + Intergenic
1065527838 10:26640713-26640735 AAGCCAGCCCCAGTCAGGGCCGG + Intergenic
1065528744 10:26647966-26647988 AAGCCAGCCCCAGTCAGGGCCGG + Intergenic
1065558480 10:26939581-26939603 AAGCCAGCCCCAGTCAGGGCTGG - Intergenic
1065558706 10:26941411-26941433 AAGCCAGCCCCAGTCAGGGCCGG - Intergenic
1066132805 10:32410426-32410448 AACCCAACTCCAGGAAGATCTGG + Intergenic
1071835584 10:89414607-89414629 ACCCCAGCCCCAGCAAGAACAGG - Exonic
1072456425 10:95580259-95580281 AGCCCAGCCCCATTATGTTTAGG - Intergenic
1073124795 10:101142393-101142415 AACCCAGAACGAGTGAGTTCTGG + Intergenic
1073888081 10:108064682-108064704 AACCATGTCTCAGTAAGTTCAGG - Intergenic
1073948379 10:108778743-108778765 AACCCAACCCCATTAAGATGTGG - Intergenic
1075289796 10:121219150-121219172 AATCCAGCCAAAGTAATTTCAGG + Intergenic
1075945199 10:126427003-126427025 ACCCAAGCCCCAGTAAGATTAGG + Intronic
1076405530 10:130209999-130210021 AAACCAGGCCCAGTGATTTCAGG + Intergenic
1079464722 11:20718750-20718772 AACTCAGCCCCAGTACGATGAGG + Intronic
1081851701 11:46278669-46278691 AAGCCAGGCCCAGAAATTTCAGG + Intronic
1082976469 11:59077181-59077203 AGCCCAGCCCCAGTGACTCCAGG - Intergenic
1084690948 11:70726243-70726265 AACCCAGCCCCAGGGAGCTCAGG - Intronic
1086377231 11:86213755-86213777 AACACTGCCCCATTGAGTTCTGG - Intergenic
1090203569 11:124872769-124872791 ACCCCAGCCCCTGAAACTTCCGG - Intronic
1093020027 12:14194788-14194810 AAGCCTGCCCCAGGAAATTCAGG + Intergenic
1095298682 12:40556985-40557007 AACACATCCCCAGCAAATTCTGG - Intronic
1099186612 12:79521908-79521930 AACCCTGCCCCAGTTACCTCAGG - Intergenic
1099722765 12:86384474-86384496 ATCCCAGCCCCAGTAAGGCAGGG + Intronic
1100200805 12:92296025-92296047 AACCCAGCCCCAGGAAGAGCTGG - Intergenic
1100813704 12:98365015-98365037 CATCCAGCCACAGTAAGTTCTGG + Intergenic
1102954138 12:117048527-117048549 AGACCAGCCCCACTATGTTCTGG - Intronic
1107444526 13:40458359-40458381 AGCCCAGCCCCAGCAAATTAGGG + Intergenic
1108873737 13:55018936-55018958 AACCCAGCCCCAGTACATCCAGG + Intergenic
1111057336 13:82968559-82968581 CCCCCAGCCCCAGTACGTACAGG - Intergenic
1114712050 14:24788537-24788559 AACATAGCCCCAGGAATTTCTGG + Intergenic
1123042698 14:105496862-105496884 AACCCATCCCCTGTAACTTCAGG - Intronic
1128762976 15:70230461-70230483 AACCGAGGCCCAGTGGGTTCTGG - Intergenic
1130907824 15:88252589-88252611 AACCCAGCCCCAGGTAGGCCTGG + Intronic
1133201860 16:4208723-4208745 AACCCTGTCCCAGTAAGGGCAGG + Intronic
1133395573 16:5444585-5444607 ATCCCAGCCCCAGAAATTACGGG + Intergenic
1134299844 16:12981172-12981194 AAGTCAGCCCCAGTGAGTTCAGG + Intronic
1134855807 16:17518068-17518090 AACCCAGCCCCAGCAAGGACAGG + Intergenic
1135193347 16:20373493-20373515 AACCCAGTCCCAGGAGATTCAGG + Intronic
1138207166 16:55133545-55133567 GACCCAGAGACAGTAAGTTCTGG - Intergenic
1139934771 16:70561591-70561613 AACCCAGCTCCAATAAGGTTTGG - Intronic
1142123364 16:88398066-88398088 AACAAAGCCCCAGAAAGTGCTGG + Intergenic
1143611232 17:8018931-8018953 AATCCAGCACTTGTAAGTTCTGG + Intronic
1143953755 17:10653431-10653453 CACCCAGCCCCAGCATGCTCAGG + Intronic
1144362452 17:14508277-14508299 ACCCCAGCCCCAGCAACTGCTGG + Intergenic
1144887887 17:18476451-18476473 TACCCAGCCCCATTATTTTCTGG + Intergenic
1151118573 17:71766760-71766782 AACCAAGCCCCAGAAAGAACTGG + Intergenic
1151539664 17:74758603-74758625 AACATAGCCCCAGTGAGTTCCGG - Intronic
1152297475 17:79476541-79476563 AACCCCACGCCAGTCAGTTCAGG + Intronic
1154589422 18:16217321-16217343 AACACATCCCGAGTAAGTTTCGG - Intergenic
1161489966 19:4556413-4556435 CACCACGCCCCAGTTAGTTCTGG - Intronic
1162374324 19:10295998-10296020 AACCCAGCCCCAGGAGCTTCAGG - Intronic
1162492221 19:10999930-10999952 CACCCGGCCCCAGTAACTTCTGG - Intronic
1162793053 19:13072884-13072906 AAACCAGCCCCAGGAGGCTCCGG - Intronic
1165071246 19:33256078-33256100 AACCCAACCCCACTCAGATCCGG - Intergenic
1166570666 19:43794726-43794748 AACCCAGCCTCACAAAGTGCTGG + Intergenic
1166654122 19:44597643-44597665 AACTCAGCCCCACAAAGTGCTGG + Intergenic
1202686214 1_KI270712v1_random:52764-52786 AACCCTGCCCCAGAAAGTCCAGG - Intergenic
925386774 2:3467554-3467576 AACCCAGCCCCAGTAAGTTCCGG + Intronic
926061639 2:9808394-9808416 AACCAAGGCCCAGAGAGTTCTGG - Intergenic
926128343 2:10285505-10285527 AACCCAGCTTCAGAGAGTTCTGG + Intergenic
927918019 2:26948999-26949021 AACTAAGACCCAGAAAGTTCAGG + Exonic
928865709 2:35915474-35915496 AACTGAGGCCCAGGAAGTTCAGG - Intergenic
929168374 2:38906403-38906425 AAACCAGCCCCAGCATGTTCTGG + Intronic
932987167 2:76740039-76740061 AACACAGCCTCAGAAAGTACTGG + Intergenic
934245509 2:90302056-90302078 AACCCTGCCCCAGAAAGTCCAGG + Intergenic
934263237 2:91494983-91495005 AACCCTGCCCCAGAAAGTCCAGG - Intergenic
935201918 2:100864421-100864443 AACCCAGCACCATTAAATGCGGG - Intronic
937039989 2:118813703-118813725 AACCCAGCCCCAGCCAGCCCAGG - Intergenic
938113498 2:128587582-128587604 AACCCAGGGACAGTAAATTCAGG - Intergenic
939746349 2:145974223-145974245 AACCAAACCACAGTAAGTTAAGG + Intergenic
939746404 2:145975542-145975564 AACCAAACCACAGTAAGTTAAGG + Intergenic
945900890 2:215536312-215536334 AACCCATCCCCAGTATTTTTGGG - Intergenic
948295497 2:236857269-236857291 AACCCAGCCCCAGAGAGTGGGGG - Intergenic
1171117059 20:22534080-22534102 CACCCAGCCCCAGTTATTTGTGG - Intergenic
1172063484 20:32203258-32203280 AACCTAGGCCCAGGTAGTTCTGG + Intronic
1173534739 20:43800874-43800896 CACCCAGCCTCAGTAGGTGCTGG + Intergenic
1175195072 20:57237417-57237439 AAGTCAGCTCCAGTGAGTTCTGG - Intronic
1176362802 21:6012272-6012294 GACACAGCCCCAGGAAGTTCTGG + Intergenic
1177070454 21:16499247-16499269 AAACCAGCCACAGTCAATTCAGG + Intergenic
1179760716 21:43526273-43526295 GACACAGCCCCAGGAAGTTCTGG - Intergenic
1181549426 22:23628685-23628707 GTCCCAGCCCCAGGAAGATCAGG + Intronic
1181799187 22:25333198-25333220 GTCCCAGCCCCAGGAAGATCAGG - Intergenic
1182278246 22:29203807-29203829 ATCCCAGCCTCAGTAAGGACAGG + Intergenic
1182624053 22:31633226-31633248 AACCAAGCCCCAGTTAGACCAGG + Intronic
1185157315 22:49201834-49201856 AACCCTGCCCCAGCCAGTCCAGG + Intergenic
950146931 3:10656823-10656845 AAGCCAGCCCTGGGAAGTTCCGG + Intronic
957277855 3:78112227-78112249 AATCCAGTCCCAGTCATTTCAGG + Intergenic
961672746 3:128546893-128546915 AGCCCAGCCCCAGTGAAGTCTGG - Intergenic
967175320 3:186857551-186857573 AACCCTGCCCCAGAGAGTTTAGG - Exonic
968137002 3:196226999-196227021 AGCCCAGCGCCAGCAAGGTCAGG - Exonic
968747095 4:2365664-2365686 AACCCAGGCCCAGCCAGTGCTGG - Intronic
969102072 4:4776874-4776896 TACACAGCCCCAGTAAGTTGGGG + Intergenic
969130257 4:4985899-4985921 AATCCAGCTCCAGTTAGTGCAGG - Intergenic
969359859 4:6656698-6656720 TACCCAACTCCACTAAGTTCAGG + Intergenic
978945463 4:114490637-114490659 ACCCCAGCCCCAGTATGTCCAGG + Intergenic
979214962 4:118152188-118152210 AATTCAGCCCCAGTGAATTCAGG - Intronic
985802185 5:2011883-2011905 AACCCAGCCCCACCCAGTCCTGG - Intergenic
990711992 5:58593069-58593091 AACCGAGCCTCAGTTAGTTGTGG - Intronic
997513420 5:134468095-134468117 AACTCAGCCTCAGTGAGTCCGGG + Intergenic
999479892 5:151938236-151938258 AACCCAGCCACTGGAAATTCAGG - Intergenic
1000239767 5:159398560-159398582 AGCCCATCCCAGGTAAGTTCTGG + Intergenic
1001932145 5:175680759-175680781 AGCCCAGCTCCCGTAAGTTCTGG - Intronic
1001956925 5:175854064-175854086 TACCCAGCCCCAGCACTTTCTGG - Intronic
1007312053 6:40954466-40954488 AGCCCAGCCCCATAAGGTTCAGG - Intergenic
1009548351 6:65052187-65052209 TACCCAACCCCATTTAGTTCTGG + Intronic
1013638484 6:112051025-112051047 AACCCAGCGCCAGTGTGTTCTGG + Intergenic
1019049110 6:169169796-169169818 AAACCAGCCCCTGTAACCTCTGG - Intergenic
1022496952 7:30859340-30859362 AGCCCAGCCCCAGGGAGTTGAGG - Intronic
1023613249 7:41992811-41992833 TTGCCAGCCCCAGTAAGTTTGGG + Intronic
1026777819 7:73242082-73242104 AACCCAGAGCCAGAAAGGTCAGG - Intergenic
1026848200 7:73709271-73709293 CTCCCAGCCACAGTAAGATCTGG + Intronic
1027018671 7:74795475-74795497 AACCCAGAGCCAGAAAGGTCAGG - Intergenic
1027069358 7:75150464-75150486 AACCCAGAGCCAGAAAGGTCAGG + Intergenic
1027226008 7:76244040-76244062 AACCTAGCTCCACCAAGTTCAGG - Intronic
1030292901 7:107889888-107889910 AACAAAGCCCAAGAAAGTTCAGG + Intergenic
1030754972 7:113276352-113276374 AACCCAGCCCCATTAAAAACGGG + Intergenic
1031077261 7:117224970-117224992 ACCCCAGACCAAGAAAGTTCCGG - Intronic
1035346948 7:158206542-158206564 CACCCAGCTCCAGGAAGCTCGGG + Intronic
1035393830 7:158522933-158522955 ATCTCAGTCCCAGCAAGTTCTGG - Intronic
1038168854 8:25110433-25110455 AACCTGGCCCCAGTACCTTCAGG + Intergenic
1042286913 8:67123851-67123873 ATCCCAGCCCCACAAAGTGCTGG + Intronic
1045560254 8:103254755-103254777 CCCCCAACCCCAGTCAGTTCAGG - Intergenic
1048464883 8:134657263-134657285 AACCCAGCCCTAGTACCTACTGG - Intronic
1048551400 8:135436795-135436817 AACCCAGGCCAAGTGAGTTGTGG + Intergenic
1050110742 9:2212983-2213005 AACTCAGGCCCAGAAAGATCTGG - Intergenic
1050422482 9:5481023-5481045 AACCAAGCCACAGAAAGTTTAGG + Intergenic
1056061741 9:82890384-82890406 AACACAGCCTCAGGAAGTCCTGG + Intergenic
1057067432 9:92068589-92068611 ATCCCAGCCCCAGAAAGTGATGG - Intronic
1060478875 9:124005719-124005741 AACCCAACTCCAGTCAGTGCTGG + Intronic
1062454012 9:136627246-136627268 ACCCCAGCCCCAGCCAGTCCTGG - Intergenic
1062560261 9:137138525-137138547 ACCTCAGCCCCAGTCAGTGCGGG + Intronic
1187483892 X:19683915-19683937 AATCCAGCCCAAGAAAGTTAAGG - Exonic
1187732008 X:22264808-22264830 AACCGACCAGCAGTAAGTTCAGG + Intergenic
1188067494 X:25679883-25679905 AACCCAGCCCAAATCAGTTGCGG - Intergenic
1194207513 X:91029613-91029635 AGCCCAGCCCCTCTAAGTTGCGG + Intergenic
1195119100 X:101731935-101731957 ACCCCAGCCCCACAAAGTGCTGG - Intergenic
1196155016 X:112419169-112419191 AACCAAGCCCCAGAAAGAACTGG + Intergenic